EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03862 alignment
(2 sequences with 384 bp)


SP55_BACSU/1-119 ATGGACTACCTTTTGGCTTTTGTCTGCGGCGGGGCCATCTGTATCGTCGGCCAG------------CTGCTCTTGGATATTTTTAAATTGACGCCA------------GCTCATGTCATGACATCATTTGTTGTAATCGGTGCAATATTAGATGGTTTCGGCATTTACGATAAATTTATTGAATTTGCCGGAGGAGGCGCCATTGTTCCGATCGTCAGCTTCGGTCACAGTCTTCTGCACGGCGCCATGCATCAGGCGCATATACACGGATTTATCGGAATCGGCATGGGGATTTTTGAGCTGACCTCGGCCGGTATCTCAGCCGCTATTCTTTTCGCCTTTATCGTAGCTGTTATT---TTCAAAGCCGAAAGGATAAGTGCC
SP53_BACSU/23-150 TGGAACTGTGTAAAAGCCTTTTTAGTGGGCGGACTGATTTGTGCAATCGGGCAAGGTCTGCAAAATTTTTATATCCATTTTTTTGATTTCAATGAAAAAACTGCGGGGAATCCAACAGCTGCAACGCTGATATTAATTTCTGCCCTGCTTACAGGGTTTGGAATCTATGACAGAATCGGACAATTCGCAGGCGCAGGTTCAGCCGTACCTGTCACGGGTTTTGCCAACAGTATGGCAAGTGCGGCTCTTGAATATAAAAGCGAAGGATTAGTGCTTGGAGTAGCGACAAATATGTTTAAACTGGCAGGAAATGTTATTGTTTTCGGAGTTGTAGCTGCATACATCGTTGGAATGATTCGGTTTGCTTTTGAGAAACTGATGTCA