EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03672 alignment
(5 sequences with 192 bp)


Y265_UREPA/46-109 ATTGGAATTGTTTTATTTTTAATCGCAGGACTTATTATCGGTTATTTTATTTCGATGAAAATTATGAAACGCCAATTGAAGAAGAATCCACCAATTTCAAAGGATACAATTCGTATGATTTATCAACAAGTAGGACGTAAGCCAAGTGAGTCACAAATTAATGAGATTTATAATCGGGCAGTAAAACAAAAA
Y33A_MYCGE/10-73 TTAGGTATCCCTCTTTCGCTTTTGGTGGGAATGATTCTTGGTTATTTTATTTCTATAAAAATCTTTAAAAAACAGATGCGTGACAATCCACCTATTACTGAAAATCAAATTAAAGCAATGTATGCAAAAATGGGTAGAAAATTATCTGAAACCCAGGTAAAAGAGATAATGCGCTCCATTAAAAACCAAAAA
YNBE_LACLA/8-71 TTGCTTATGGTTGTATGCCTTTTGGCAGGTTTTTTCTTGGGAACATGGTTCTCACAACGCCAAACAAAAAAATTACTTATGGATAACCCACCCCTTAATGAAGACGCTGTTCGTCTTATGATGGGATCTATGGGACGTAAACCAAGTGAAGTTCAAGTCCAACAAGTTCTTCGCCAAATTCGTGCTGCTGCA
YNEF_BACSU/8-70 CTAGTGGGCGTTGTTGCATTGCTCATAGGTGTTGCACTCGGGTTTTTTATTGCTCGTAAATATATGATGAGCTACCTGAAAAAGAATCCGCCTATTAATGAACAAATGTTACGCATGATGATGATGCAAATGGGAATGAAACCTTCTCAAAAGAAAATCAATCAAATGATGAAAGCCATGAATAAT---CAA
Y2350_BACHD/7-70 CTTTGGATTACATTAGGTATTGTCATCGGTATTGCGATTGGCTTTTTTATTGCTCGTAAGACGATGATGTCCTATTTGAAGAAAAACCCACCCATCAATGAGCAAATGCTTCGCGTCATGTTAATGCAAATGGGGCAAAACCCTTCGCAGAAGAAGATTAATCAAATGATGAAAGCGATGCAGAAGCAGCAA