EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03642 alignment
(10 sequences with 264 bp)


Q9XAS5_STAAU/489-576 GTGAAGTTTCCAGTAACGATAAATGGATTTTCAAATTTAGTTTCAAATGAATTTGCGTTTTTACATCCACATAAAATAACAACAAACGACTTGAATGCTAAACTTAGACTAGCGTTAGCAAGCGATCAAGGTATTACTAAACATGATATTGGACTTTCTGAACGCACTGTGTATAAAGTGTATTTTAAAGACGGGTCATCAAAATTTGTTGACTTAAAAGCTGCGAAACAAGATTCAAAAGTATTTAAAGCAACTGACATTAAA
Q99QS2_STAAM/11-98 GTGAAATTCCCAGTAACAATAAATAAATTTGAAAACATAGTTTCAAATGAATTTGTGTTCTATAATGCAAGCAAAATTACAATTAATGATTTAAGTATAAAACTTAAATCAGCAATGGCAAATGATCAAGGGATAACTAAACATGACATAGGACTTGCTGAACGCGCAGTGTATAAAGTGTATTTTAAAAATGGTTCGTCAAAATATGTAGACTTAAAAACTGAGTATAAAGATGAAAGAGTATTTAAAGCAACTGACATTAAA
Q99VA9_STAAM/48-135 GTTCCATATACAATTGCAGTAGATGGCATTATGGCTTTCAATCAATCTTACTTAAATTTACCAAAAGATAGCCAATTATCATATTTAGATTTAGGAAATAAAGTTAAAGCTTTATTATATGATGAACGTGGTGTAACACCTGAGAAGATTCGAAATGCAAAATCTGCCGTTTACACGATTACTTGGAAAGATGGTAGTAAAAAAGAAGTGGATCTTAAGAAAGATAGCTACACAGCAAACTTGTTTGATTCAAATTCAATTAAA
Q99S64_STAAM/47-134 GTGCCTTACACGATCTCAGTAGATGGTATTACTGCATTACATCGAACTTACTTTGTTTTTCCAGAAAATAAAAAGGTACTTTATCAAGAAATTGACAGTAAAGTAAAAAATGAATTAGCTTCACAACGTGGTGTTACAACAGAAAAAATTAATAATGCACAAACAGCAACGTATACACTTACTTTGAATGATGGTAATAAAAAAGTAGTGAATCTAAAGAAAAATGACGACGCTAAAAATTCAATTGATCCAAGTACAATCAAA
Q99QS1_STAAM/160-247 GTGCCATATACAATCACAGTGAACGGCACAAGCCAAAACATTTTATCAAACCTAACATTTAATAAAAATCAAAATATTAGTTACAAAGATTTAGAGGGTAAAGTTAAATCAGTTTTAGAATCAAATAGAGGTATTACTGATGTTGATTTAAGACTTTCGAAGCAAGCGAAATATACAGTTAATTTTAAAAATGGAACGAAGAAAGTTATCGATTTGAAATCAGGTATTTACACAGCGAATTTAATCAATTCAAGTGATATTAAA
Q9S2Z4_STAAU/374-461 GTACCATACACAATTGCAGTAAATGGCACATCAACACCAATTTTATCAGATTTAAAATTTACAGGTGACCCACGTGTAGGCTACAAAGATATCACTAAAAAAGTTAAATCAGTATTGAAGCATGATAGAGGTATCGGGGAACGTGAATTAAAATATGCAAAAAAAGCAACTTACACAGTACATTTTAAAAATGGAAAGAAAAAAGTGATTAATTTAAACTCAAAAATTAGCCAACTGAATCTGCTTTATGTTCAAGATATTAAA
Q9XAS5_STAAU/376-463 GTACCATATACAATTGCAGTAAATGGAGCATCAAATCCAACTTTATCAGATTTAAAATTTACAGGTGACTCACGTGTAAGCTACAGTGATATCACGAAAAAAGTTAAATCAGTATTGAAACATGATAGAGGTATCAATGATATTGAATTGAAATTTGCGAAACAAGCAAAGTATACTATACACTTTAAAAATGGAAAGACACAAGTCGTTGACCTTAAATCAGATATCTTTACAAGAAATTTATTCAGTGTCAAAGATATTAAA
Q9Z4P5_STAAU/481-568 GTACCATACACAATCGCAGTAAATGGGACATCAACACCTATTGCATCAAAACTAAGACTTTCGAATAAACAATTAATTGGTTATCAAGATTTAAATAAAAAAGTTAAATCAGTTTTAAAACATGATAGAGGTATCAATGATATTGAATTGAAATTTGCGAAACAAGCAAAGTATACTGTACACTTTAAAAATGGAAAGACACAAGTAGTTGACCTTAAATCAGATATCTTTACAAGAAACTTATTCAGTGTCAAAGATATTAAA
Q9Z4J2_STAAU/432-519 GTACCATATACAATTGCAGTAAATGGCACATCAACACCAATTTTATCAAAACTTAAAATTTCGAATAAACAATTAATTAGTCACAAATATTTAAATGACAAAGTGAAATCTGTATTAAAAAGTGAAAGAGGCATCAGTGATCTTGACTTAAAATTTGCGAAACAAGCAAAATATACAGTATATTTCAAAAATGGAAAGAAACAAGTAGTGAATTTAAAATCAGACATCTTTACACCTAATTTATTTAGTGCCAAAGATATTAAA
Q9XAS5_STAAU/271-358 GTGCCATATTCAATTAATTTAAATGGTACAACAACTAATATTCAATCTAATTTAGCATTTTCAAATAAACCTTGGACAAATTACAAAAATTTAACAACAAAGGTAAAATCAGTATTGAAATCTGACAGAGGCGTTAGTGAACGTGATTTGAAACACGCAAAGAAAGCGTATTACACTGTTTACTTTAAAAATGGTGGTAAAAGAGTGATACATTTAAACTCGAATATTTATACAGCTAACTTAGTTCATGCGAAAGATGTTAAG