EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03634 alignment
(17 sequences with 807 bp)


Q9CA43_ARATH/74-283 GTTGATGGAAGCACCTCACAAGAGGTTCAATGGAGAAGGACGGTCAAAAAAAGGGACAGGCATAGTAAGATCTGCACGGCTCAAGGTCCTAGAGACCGGAGGATGAGGCTGTCTCTTCAGATTGCTCGCAAGTTTTTCGATCTTCAAGACATGTTGGGTTTCGACAAGGCGAGCAAGACGATTGAATGGCTTTTCTCCAAATCAAAGACTTCCATCAAACAACTTAAAGAAAGAGTGGCTGCATCGGAAGGAGGAGGAAAGGATGAACATCTCCAGGTT---------------------------------------------------...------...------------------------------------------------------------------------------GATGAAAAGGAAAAGGATGAGACACTGAAGTTGAGAGTCTCAAAGAGAAGAACAAAGACTATGGAGAGCTCTTTTAAGACTAAAGAGTCGAGAGAGAGAGCTAGAAAGCGAGCAAGAGAGAGAACAATGGCAAAGATGAAGATGAGATTATTTGAGACCTCGGAAACAATTTCAGATCCT------------------------------------CATCAAGAAACTAGAGAGATCAAGATAACCAATGGTGTACAATTACTAGAAAAGGAAAATAAAGAACAAGAATGGAGTAATACTAATGATGTTCACATGGTAGAGTATCAAATGGATTCTGTGAGCATCATAGAGAAGTTTCTTGGACTAACCAGTGACTCTAGCTCCTCT
Q9FUE7_POPDE/106-351 GATACTTCAAAGCAG------------CCAATTCGTCAAAGGCGAACCGGGAAGGACAGGCACAGCAAGATCCATACTGCTCAAGGGCCTAGAGATCGAAGGATGAGGTTATCCCTTCAAATTTCCAAAAAGTTCTTTGATCTCCAAGACATGCTCGGCTTCGATAAAGCAAGCAAAACTATTGAGTGGCTCTTTACAAAATCGAAGGCCGGGATCAAGGAGCTCACAGATAGT------GTTCCAGGAGGGAGAAGAAGATGTAGCATTTGTGCTGACGGCAAGAGTGTTTGT------------------------------------...------...---TCCACTCCAGAGAGCGAGGTTGTTTCAGGCATCAAGCTGACACCTGAGACTAACGGGGACAAGAGAGGGACGAAGGCAAAGAATGACTCATTAGTGAGCAATCCTAAAGAGAAAAGGAGCAAGAAAGTGCACAAACCAGTCTTTAATCTTGTTGACAGAGATTCTAGGGAGAAGGCGAGAGCAAGGGCGAGGGAGAGGACAAGAGAGAGGATGAAGAACCAAGGCATAGACACGTCTAGTGATCGGTCTTCTCAGGCAAACCCTAACAAATTGGAAAAGTTTGAGTCTTCTAGCCCCCTCGAATATGGTGAAAATTTGGCTCCTGTAAACCAAGAAATGAGTTCTCCATTGAAGGTTGGTGATGTAAAAGAATCCAGCAATCATGACTTGCTACCACATCAAATGGATTATGTCAGCATCACTGGGAATTTCTTTTGGATCACAAATTCACCAAGATCATCT
Q9XGR9_LINVU/79-321 GATCCTGCCAATATGGCAGAAACATTCCAAACCAAACAAAGTACTGTGAAAAAGGACCGGCACAGCAAGATATACACTGCTCAAGGGCCGAGAGACAGGAGAGTTCGTCTGTCCATCGGCATTGCAAGGAAGTTCTTTGATCTACAAGAGATGCTAGGTTTCGACAAGCCAAGCAAGACCCTCGACTGGCTCCTTACTAAGTCGAAAACAGCCATAAAAGAGCTAGTGCAGTCCAAAAGTACGAAGAGCAATTCTTCT------------------------------------------------------------------------...---AATtccCATTCTGATGATGATTGTGATGATGAGGTTGTGTCTGCCGAAGGAGATTCTGAGAACGCTGCAGATTCGAAGGGGAAGTCGGTGCTTATAAAAGGTAACTACAAATGTAAAGAAGCTGCTTCTGCAATGGATTCTCAACAAGCAGCACTCAATCTCGTGAAAGAGTCGAGGGCAAAGGCGAGAGCAAGAGCTAGGGAAAGAACCAAGGAGAAAATGTGTATCAAACAACAACTGAATGAAGCTAGGAACAACAACAAGGGTGGTGACTGGATCAATAATCCCTTCAACAATGTAATCCAGTCTAACAGGAACCATCAACAGTTCGAAAGTCGCGAGGCGGCATTTGTTCATCATCCGGTTTTTGGGTTTCATCAGCAAAACTACAGCAACGCATCTGCCTCCTCTCATGAGAACTGGGATCAGTCGAACCAGCTATGCGCCATTTTGAATCAGCACAAGTTCATC
Q9FYG7_ARATH/77-314 GAGGTGTCAAAG------------------GAAATCAAGAAGGTGGTGAAGAAGGACCGACATAGCAAGATTCAAACGGCACAAGGGATTAGAGACAGGAGGGTTAGGCTTTCTATTGGGATTGCTCGCCAATTCTTTGATCTTCAGGATATGTTGGGGTTTGATAAAGCTAGTAAAACGTTAGACTGGCTGCTCAAGAAGTCAAGAAAAGCCATCAAAGAGGTCGTACAAGCAAAAAACCTCAACAATGATGATGAAGATTTTGGAAACATTGGAGGC---------------------------------------------------...------...---GATGTAGAACAAGAAGAGGAGAAGGAGGAGGATGACAATGGCGATAAGAGCTTCGTGTATGGTTTGAGCCCCGGGTACGGTGAAGAAGAAGTGGTATGTGAGGCCACGAAGGCAGGGATAAGAAAGAAGAAGAGTGAGTTGAGAAACATCTCATCAAAGGGGCTAGGAGCCAAAGCTAGAGGAAAAGCAAAGGAGCGAACAAAAGAGATGATGGCCTATGATAATCCAGAGACTGCCTCTGATATTACACAATCT---------GAAATCATGGACCCATTCAAGAGGTCTATAGTCTTCAATGAAGGAGAAGATATGACACACCTTTTCTACAAGGAACCAATCGAGGAGTTTGATAATCAAGAATCTATCTTAACCAATATGACTCTACCAACGAAGATGGGTCAAAGTTACAATCAAAATAATGGGATACTTATGTTGGTAGATCAGAGTTCTAGCAGC
Q9LII4_ARATH/132-395 ATCTCAACTTCTCAAGACCCAAAAATGAAAAAAGCCAAGAAACCCAGCAGAACGGACAGGCACAGCAAGATCAAAACGGCCAAAGGGACACGAGATCGTAGGATGAGACTCTCGCTAGATGTCGCCAAAGAGTTGTTTGGCTTACAAGACATGCTTGGATTTGACAAAGCCAGCAAAACCGTTGAATGGTTGCTTACACAAGCAAAACCTGAGATCATAAAGATCGCGACAACCCTTTCTCACCATGGCTGCTTCAGCAGCGGCGATGAGTCTCATATCCGACCGGTGTTAGGATCCATGGACACATCTTCTGATCTATGTGAACTTGCA...------...---TCCATGTGGACGGTCGACGATAGAGGCAGCAATACTAACACGACCGATAAATTATCTTATACATTAGAAACAAGAGGAAACAAGGTCGATGGGAGATCGATGAGAGGGAAGAGAAAGAGGCCAGAACCGCGAACGCCCATTTTAAAGAAGTTGTCCAAGGAGGAGAGAGCGAAAGCTAGAGAAAGAGCAAAGGGTAGAACAATGGAGAAAATGATGATGAAGATGAAAGGAAGATCACAATTAGTGAAAGTTGTGGAAGAAGACGCTCATGATCATGGTGAGATAATAAAGAATAATAATAGAAGCCAAGTGAATCGGAGTTCTTTTGAGATGACACACTGCGAAGACAAGATCGAAGAACTTTGCAAGAACGATCGTTTTGCAGTTTGCAACGAATTTATCATGAATAAGAAAGATCACATTTCAAATGAATCTTATGACTTAGTCAACTACAAACCGAAC
Q9LKA2_ARATH/15-280 GGCGAGATTGTTGAGGTGCAAGGTGGTCACATTGTTCGGTCTACCGGAAGAAAAGACCGCCACAGCAAAGTCTGCACGGCTAAAGGGCCACGTGACCGGCGCGTGAGACTCTCTGCTCACACGGCGATTCAGTTTTACGATGTTCAAGACAGGCTTGGTTTCGACCGACCTAGCAAAGCCGTTGATTGGCTTATCAAAAAGGCTAAGACTTCCATTGACGAGCTCGCTGAGCTTCCTCCCTGGAATCCCGCCGATGCAATTCGCCTAGCCGCTGCTAACGCTAAACCCAGAAGAACCACCGCCAAAACCCAAATCTCTCCGTCTCCGCCAccgCCG---...---CAACAGCAACAACAACAACAACAGCTTCAGTTCGGTGTTGGCTTCAACGGAGGAGGAGCAGAGCATCCGAGTAACAACGAGTCGAGTTTTCTCCCGCCGTCAATGGATTCAGATTCGATAGCTGACACTATAAAGTCGTTTTTTCCGGTGATTGGCTCTTCAACGGAGGCTCCTTCGAATCATAACCTTATGCACAACTATCATCATCAGCATCCGCCGGATTTGCTTTCTCGAACTAATAGCCAAAACCAAGATCTCCGTCTCTCGCTGCAATCGTTCCCGGATGGTCCACCGTCGCTTCTGCACCACCAACATCACCACCACACCTCTGCTTCCGCCTCCGAGCCTACTCTGTTCTACGGACAGAGCAATCCGTTAGGGTTTGACACATCGAGTTGGGAGCAGCAGTCGTCGGAATTCGGAAGGATTCAGAGACTAGTGGCTTGGAACAGCGGCGGTGGC
Q9S7W5_ARATH/58-293 ATGAAATCCAAGGATCCGAGGATTGTTAGGGTTTCACGCGCCTTTGGAGGCAAAGACCGTCACAGCAAAGTGTGTACGTTACGTGGACTACGTGACAGACGCGTGAGATTATCAGTCCCAACGGCTATTCAGCTCTACGATCTTCAAGAACGGCTCGGTGTTGACCAGCCTAGCAAAGCCGTTGACTGGTTGCTTGATGCAGCTAAAGAGGAGATCGACGAGCTACCTCCGTTACCTATCTCGCCGGAAAATTTCAGCATCTTCAAC---------------------------------------------------------------...------...------------------------CATCATCAGTCCTTCTTGAATCTTGGTCAACGGCCCGGTCAAGATCCGACCCAACTCGGGTTTAAAATCAATGGATGTGTACAAAAGTCTACTACTACTAGCCGCGAAGAAAACGATAGAGAGAAAGGAGAAAACGATGTCGTTTACACAAACAATCATCATGTTGGGTCTTATGGAACTTATCACAACCTGGAACATCATCATCATCATCACCAACATTTGAGTTTACAGGCAGATTATCATAGTCATCAACTACATAGTCTTGTCCCATTTCCATCACAAATTTTGGTATGTCCAATGACGACATCACCAACAACTACAACTATACAATCTTTGTTTCCATCATCATCGTCAGCTGGTTCAGGGACTATGGAGACATTAGATCCGAGGCAAATGGTAAGCCATTTTCAAATGCCATTAATGGGTAATTCTTCATCTTCG
Q9LEZ9_ARATH/17-195 CAACGATGGAATAATCCGAGGATCGTGCGAGTCTCCCGAGCATTTGGAGGCAAAGATAGACACAGCAAAGTGTGCACAGTTCGTGGTCTCCGAGACAGGAGGATAAGGTTGTCGGTGATGACAGCGATCCAAGTCTACGACCTTCAAGAACGATTAGGGCTGAGTCAGCCTAGCAAAGTCATTGATTGGCTCTTAGAAGTTGCCAAAAACGACGTCGATTTGCTTCCTCCTTTGCAATTCCCACCTGGTTTTCACCAACTTAAC------------------------------------------------------------------...------...------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTAATCTCACCGGCCTTGGAGAATCTTTTCCCGGGGTCTTCGATCTTGGAAGAACACAGAGAGAAGCTTTGGATCTTGAGAAAAGGAAATGGGTTAATCTTGATCATGTGTTTGATCACATCGATCATCACAACCATTTCTCGAATTCAATCCAGAGCAACAAGCTTTATTTCCCTACAATTACTTCGTCTAGCAGCTCTTATCACTACAACCTTGGACATCTCCAACAGTCACTACTAGACCAATCTGGTAACGTCACTGTCGCATTTTCT
Q9C758_ARATH/40-241 CGTATCATTAGG------------------GTTTCACGAGCTTCTGGTGGCAAAGATAGACATAGCAAAGTGTTAACATCAAAAGGTTTAAGAGATCGAAGAATACGTCTCTCAGTTGCTACAGCAATCCAGTTCTATGATCTTCAAGATCGTCTTGGATTTGATCAGCCAAGTAAAGCTGTTGAATGGTTAATCAATGCAGCTTCTGATTCAATCACTGATCTTCCTTTGCTTAACACA------------------------------------------------------------------------------------------...------...---------------------------------------------------------------------AATTTTGATCATCTTGATCAGAATCAGAATCAGACCAAATCTGCTTGTAGTAGTGGAACATCTGAGAGTTCGCTGTTGTCGTTATCAAGAACAGAGATTCGTGGGAAAGCAAGAGAGAGAGCTAGAGAAAGAACAGCTAAAGACAGAGATAAAGATTTGCAGAATGCTCATAGCTCATTCACTCAGCTT------------CTCACTGGTGGTTTTGACCAACAACCGAGTAACCGGAATTGGACCGGTGGTTCTGATTGCTTTAACCCGGTTCAGCTGCAAATACCAAACTCTTCCTCTCAAGAGCCAATGAATCACCCATTCTCCTTTGTACCTGATTACAACTTTGGAATCTCTTCTTCTTCTTCTGCCATTAATGGTGGTTACAGTAGTAGG
Q9C518_ARATH/44-302 CTCGCAACAACCTCATCTACGGCAACGGCGACTACAACGAAGCGGTCGACTAAAGACCGTCACACGAAAGTC------------GACGGAAGAGGACGTCGGATTCGTATGCCGGCGCTATGTGCAGCTAGAGTTTTTCAGTTAACGAGAGAGTTAGGTCATAAATCCGATGGTGAAACTATTGAATGGCTTCTTCAACAAGCTGAGCCAGCTATTGTTGCTGCTACAGGTACAGGAACTATTCCGGCGAACTTCTCTACTTTAAGTGTTTCGTTACGAAGTAGTGGATCGACTCTCTCTGCTCCGCCGTCGAAATCGGTGCCGCTT---...------...---TACGGTGCTCTTGGATTGACTCATCATCAGTATGATGAACAAGGAGGCGGCGGTGTGTTTGCTGCTCATACGTCGCCGCTTTTAGGGTTTCATCATCAGCTTCAACACCACCAGAACCAGAATCAGAATCAAGATCCGGTGGAAACTATTCCTGAAGGTGAGAATTTCTCTAGGAAACGGTATAGATCGGTTGATTTGTCTAAAGAAAACGATGATCGGAAACAGAACGAGAATAAATCTTTGAAAGAAAGTGAAACGTCGGGTCCTACGGCGGCGCCGATGTGGGCGGTTGCGCCGCCGAGTAGGTCTGGTGCTGGGAACACTTTTTGGATGCTTCCGGTACCGACAACGGCCGGTAATCAAATGGAGAGTAGTAGCAACAATAACACCGCCGCAGGCCACCGTGCTCCTCCTATGTGGCCATTTGTGAACTCTGCTGGAGGAGGAGCGGGAGGTGGAGGC
Q9LSD5_ARATH/62-246 AACAAGAAGAGTCAGAATCAGAACCAGCTTGGTCCTAAGAGAAGCTCTAACAAAGACAGACACACTAAAGTC------------GAAGGTAGAGGTCGACGAATTCGGATGCCTGCTCTTTGTGCTGCTAGGATTTTTCAATTGACTAGAGAATTGGGTCATAAATCTGATGGTGAAACTATCCAGTGGCTGCTTCAACAAGCTGAGCCATCGATTATTGCAGCTACTGGTTCAGGAACTATACCG------GCCTCTGCT---------------------------------------------------------------------...------...---------------------------------------------------------------------------------------------------------------------------------------------------------TTAGCTTCTTCAGCTGCAACCTCTAACCATCATCAAGGTGGGTCTCTTACTGCTGGTTTAATGATCAGTCATGACTTAGATGGTGGGTCTAGTAGTAGTGGTAGACCATTAAATTGGGGGATTGGTGGCGGTGAAGGAGTTTCTAGGTCAAGTTTACCAACTGGGTTATGGCCAAATGTAGCTGGGTTTGGTTCTGGTGTGCCAACCACTGGTTTAATGAGTGAAGGAGCTGGTTATAGAATTGGGTTTCCTGGTTTTGATTTTCCTGGTGTTGGTCATATGAGTTTTGCATCTATTTTGGGTGGGAATCAT
Q9FTA2_ARATH/15-194 GAGCAGACGTCAAACAAAGGACCTCTTAACGCCGTTAAGAAACCACCGTCTAAAGATCGACACAGCAAAGTT------------GACGGAAGAGGAAGAAGGATTCGTATGCCAATCATTTGCGCAGCTCGAGTTTTTCAATTGACCAGAGAGTTAGGTCACAAGTCCGATGGTCAAACCATAGAGTGGCTTCTCCGTCAAGCTGAGCCTTCTATCATAGCCGCCACTGGAACTGGCACTACTCCG------GCGAGT------------------------------------------------------------------------...------...------------------------------------------------------------------------------------------------------------TTCTCCACTGCTTCTCTCTCCACTTCTTCTCCGTTT---------------------------------------------------------ACTCTCGGGAAACGTGTCGTCAGAGCGGAGGAAGGAGAATCCGGCGGCGGAGGAGGAGGAGGGTTAACAGTGGGACACACAATGGGGACTTCGTTAATGGGTGGTGGTGGTTCTGGTGGGTTTTGGGCTGTTCCGGCGAGGCCGGATTTCGGACAAGTCTGGAGCTTTGCAACCGGAGCTCCACCGGAAATGGTTTTTGCGCAGCAGCAGCAACCAGCTACACTCTTCGTCCGCCACCAGCAGCAACAGCAAGCTTCCGCCGCC
O23875_ORYSA/40-161 TCCGACGGCGCCACCCCTCGCCGCGTCAGGCCCAGGAAGTCCCCCTCCTCCTCCGACCGCCACTCCAAGGTC------------GCCGGCCGCGGCCGCCGCGTCCGCATCCCGGCCATGGTGGCCGCCCGCGTCTTCCAGCTCACCCGCGAGCTCGGCCACCGCACCGACGGGGAGACCATCGAGTGGCTACTCCGCCAGGCCGAGCCCTCCATCATCGCCGCCACCGGGACGGGCGTCACCCCG------------------------------------------------------------------------------------...------...---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGGAGGCGCCCCCCGCCGCCGTCGCCATCGGCTCTTCCTCGGTCGCCGCCGCCGCCGCCGCCGGCGGGCATGGGGGCGCGTTCGTCCATGTGCCTTACTACACCGCGCTCCTCATGCAGCCGCCTAACGCG
O64647_ARATH/59-280 TCTTTAGCTCCACCGTCTTCGACAGGACCACCATTGAAGAGAGCTTCGACTAAAGACCGTCACACGAAGGTT------------GAAGGAAGAGGGAGAAGGATACGGATGCCTGCCACGTGTGCGGCTAGGATTTTTCAATTAACTCGAGAGTTAGGTCACAAATCCGACGGCGAAACGATTCGGTGGTTGTTGGAGAACGCTGAGCCGGCGATTATAGCCGCCACGGGTACGGGAACGGTTCCCGCCATCGCCATGTCGGTTAACGGAACCTTA------------------------------------------------------...------...---------------------------------------------------------------AAAATCCCGACGACGACGAACGCTGATTCTGATATGGGTGAAAATCTGATGAAGAAGAAACGTAAACGACCTTCTAACAGTGAGTATATAGACATAAGCGACGCCGTTTCAGCTTCCTCCGGTTTAGCTCCAATTGCCACGACGACAACGATCCAACCTCCGCAAGCTCTGGCATCATCCACTGTGGCTCAGCAACTTCTGCCGCAAGGAATGTATCCGATGTGGGCTATTCCATCAAACGCAATGATTCCGACGGTCGGAGCTTTCTTCTTGATTCCACAAATCGCTGGTCCGTCGAATCAGCCTCAGTTATTAGCTTTTCCCGCCGCCGCTGCTTCGCCGTCGTCTTACGTCGCCGCTGTTCAACAGGCTTCCACGATGGCTAGACCACCTCCTTTACAA
Q9SJK7_ARATH/27-186 GGTGTTTCGAAATCCTCCTCGAGCGGCGGCGGATGTATCTCCGCCAGGACTAAAGACCGTCACACGAAGGTT------------AACGGACGAAGCCGTCGAGTTACGATGCCGGCTCTCGCCGCCGCTAGGATTTTCCAGTTAACGCGTGAGCTCGGTCACAAAACTGAAGGAGAAACCATCGAATGGCTTCTTAGTCAAGCTGAACCGTCGATTATTGCCGCCACTGGCTACGGGACTAAG---------------------------------------------------------------------------------------...------...------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCATTTCGAATTGGGTTGATGTTGCGGCGGACGATTCCTCGTCGTCGTCGTCGATGACGTCGCCGCAAACGCAAACGCAAACGCCACAATCGCCGAGTTGTAGGTTGGATCTTTGTCAGCCAATCGGAATTCAGTATCCGGTGAATGGTTACAGTCATATGCCGTTCACAGCGATGCTTTTAGAGCCGATGACCACGACGGCGGAATCTGAGGTTGAGATCGCGGAGGAGGAGGAACGTAGACGCCGT
Q9FLM6_ARATH/52-227 GAAGACCAAGAAATTCAGATTCTTTATGAGAAGGAGAAGAAGAAACCAAACAAAGATCGTCACCTTAAAGTT------------GAAGGAAGAGGTCGTAGAGTTAGGTTACCTCCACTCTGTGCAGCAAGGATTTATCAATTGACTAAAGAATTAGGTCACAAATCAGATGGTGAGACTCTTGAATGGTTGCTTCAACATGCTGAGCCATCGATACTCTCTGCTACTGTAAATGGTATCAAACCCACTGAGTCTGTTGTTTCTCAA---------------------------------------------------------------...------...------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCTCCTCTCACGGCTGATTTGATGATTTGTCATAGCGTTGAAGAAGCTTCAAGGACTCAAATGGAGGCAAATGGGTTGTGGAGAAATGAAACAGGACAGACCATTGGAGGGTTTGATCTGAATTACGGAATTGGGTTTGATTTCAATGGTGTTCCAGAGATTGGTTTTGGAGATAATCAAACGCCTGGACTTGAATTAAGGCTGTCTCAAGTTGGGGTTTTGAATCCACAGGTTTTTCAACAAATGGGTAAAGAACAGTTCAGGGTTCTTCAT
Q9M1U4_ARATH/1-165 ATGGATTCGAAAAATGGAATTAACAACAGCCAAAAGGCAAGAAGGACTCCAAAAGACCGCCATTTGAAAATT------------GGTGGCCGTGATCGTCGCATTCGGATCCCGCCGAGTGTTGCTCCCCAACTATTTAGATTGACAAAAGAACTCGGCTTTAAAACCGATGGTGAAACTGTCAGTTGGCTCCTCCAGAATGCCGAGCCTGCCATTTTCGCAGCCACGGGACATGGTGTCACC---------------------------------------------------------------------------------------...------...---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCACCTCCAATGAAGATATCCAGCCAAATAGGAATTTTCCTAGTTACACCTTTAATGGTGATAATATTAGTAATAACGTTTTCCCTTGTACGGTTGTAAATACTGGTCATCGTCAGATGGTGTTTCCGGTTTCTACAATGACAGATCATGCACCTTCAACTAATTACAGTACTATTAGTGATAATTACAATTCCACCTTTAATGGTAATGCTACCGCCAGTGATACAACATCAGCAGCAACAACAACAGCCACAACCACAGTT