EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03620 alignment
(2 sequences with 279 bp)


Q9J4A7_9CORO/1-93 ATGATGAATTTATTGAATAAGTCGCTAGAGGAGAATGGAAGTTTTCTAACAGCGCTTTACATATTTGTAGGATTTTTAGCATTTTATCTTCTAGGTAGAGCACTTCAAGCATTTGTACAGGCTGCTGATGCTTGTTGTTTATTTTGGTATACATGGTTAGTAATTCCAGGAGTTAAGGGTACAGCCTTTGTATACAAGTATACATATGGTAGAAAACTTAACAATTCGGAATTAGAAGCAGTTGTTGTTAACGAGTTTCCTAAGAACGGTTGGAATAAT
VSMP_IBVP3/1-93 ATGATGAATTTATTGAATAAATCACTAGAGGAGAACGGAAGTGTCCTAACAGCATTTTATATATTTGTTGCATTTGTAGCACTTTACCTATTAGGTAGAGCACTCCAAGCATTTGTACAAGCTGCTGATGCTTGTTGTTTATTTTGGTATACATGGGTAGTAGTTCCTGGAGCTAAGGGTACAACCTTTGTGTATAAGCATACATATGGTAAAAAACTTAACAAACCGGAGTTAGAAACGGTTATTGTTAACGAGTTTCCTAAGAACGGTTGGAAACAA