EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03428 alignment
(8 sequences with 1281 bp)


O66167_9RHIZ/2-401 CAGACGCATATCTCAACGACGTCCTTTGGGCGGCGGCCGATGACACTCGGCCATATTGCAAGCCAGATGGCAGCAAAAGCGGTCGCATCAGACACTGTCGCCCACAAATGGCAGGTCTTCCAGCACATCCGTGAATCCCGGGGACTGATCGGAGCCACGGACCGCTCACTCTCGATCCTGAACGCGCTGTTGACGTTTTACCCGGAGACCGCCTTGACTGGTGGTGCCGAACTGGTCGTATGGCCTTCTAACGAACAGCTGATGGCTCGCGCCAACGGCATGCCCGCCACGACACTGCGCCGGCATCTTGCCATACTGGTTGATTGCGGGCTCATCATTCGCCGCGACAGCCCCAATGGCAAGCGGTTCGCCCGCAAGGGAAGGGGAGGGGAGATTGAGCAGGCCTATGGGTTCGATCTGTCGCCGATCGTCGCGCGGGCCGAGGAGTTCCGAGATCTGGCCCAGACAGTGCAAGCTGAAAAAAAGGCCTTCCGGGTGGCCAAGGAGCGCTTGACTCTTCTTCGTCGTGACATTGTCAAAATGATCGAAACTGGC------GTCGAA---GAGAGCGTTCCTGGAAACTGGGGAAGAGTTACCCAGACCTATCAGGGGATCATCGGCCGCCTGCCACGCTCGGCACCTCGGCAGCTT------GTCGAGAGTATTGGGCAAGAGCTTCAGGAACTTTGCATCGAGATCCGTGACGTATTGGAATCTTTCACAAAAACGATGAATCTGGACGCCAATGAGTCCCATATCGGTCGCCACAAACAGAATTCAAATCCAGACTCTAAATTTGAATCTGAATACGGCTCTGGAAAAAAAGAT---------------------------------------------------------GAAGCGGGCGGCAGCGTTGCGGAAACCGACAATGTACGGAGC...TTGCCGAAACGCGAGCTGCCTTTGGGAATCGTGCTGGATGCCTGCCCCGAAATGCGGGAATTGGCCCAGGGAGGTCCAATTCGACATTGGCGCGACTTGCTGGCGGCGGCTGAGCTTGCCCGGCCGATGCTGGGGATTAGTCCGAGCGCCTGGCGGGAGGCCCGCGAAACCATGGGCGAGCAACACGCGGCGATCACGCTGGCTTCGATCTATCAGCGGGCCGGT------CAGATCAATAACGCTGGGGGCTATCTGCGCAGCCTGACCGACCGGGCCAAGGATGGGAAGTTTTCGACCTGGCCGATGGTCATGGCGTTGCTCCGGGCGAAGCTGGACGAG
Q52227_9ZZZZ/2-401 CAGACGCATTTATCAACGACGCCCTTTGGGCGGCGGCCGATGACTCTCGGCCAGATTTCAAGTCAGATGTCAGCAAAGGCCGTGGCGCCTGACGCTACCGCAAATAAATGGCATGTGTTCCAGAATATCCGGGAGGCGAGGGAACTGCTCGGCGCAACGGATCGCTCGCTTGCGATCCTCAATGCCTTGCTGACCTTTCATCCCGAGACAACGCTTACCGGCGATGGTGAAATCATTGTATGGCCATCCAACGAACAGCTAGCGGCACGCGCCAATGGCATGCCGGCGACGACGTTGCGTCGGCATCTTGCAGTTCTCGTGGAGTGCGGCCTGGTCATCAGGCGCGATAGCCCGAACGGTAAACGCTTCGCGCGTAAGGGCAGGGGTGGCGAAATCGAGCAGGCCTACGGCTTCGATCTGTCTCCGATCGTGGCGCGCGCCAAAGAATTCAGAGATATGGCCGAAGCGATCCAGGCTGAGAAGAAAGCCTTCCGTGTCGCGAAGGAGCGGCTGACGCTGTTACGCCGTGATATCGTGAAGTTGATCGATGCGGGT------ATCGAA---GAGGGCGTTCCCGGCAACTGGTGCGGAGTGCAGCAGGTGTATCAAGCGATTATCGGCAGGCTACCACGCTCCGCACCAAGACAGCTT------GTGGAGGAGATCTGCATCGGTCTTCATGCGCTGTACATAGAAATCCGTGACGTCTTGGAATCTTTCGCAAAAACACAGATTCAGGACGCCAATGAGTCCCATTTTGGTCGTCACATACAGAATTCAAAACCAGACTCTATACCTGAATCTGAATACGGCTTTGGAAATAAACCA---------------------------------------------------------GAAGCGGGCGGCACGGTTGAGGAATTCGACAACGTGCGAAGC...CTGCCGAAGCGGGAATTGCCATTAGGAATCGTGCTGAATGCCTGCCCGAGCGTGCTGGAACTGGCTCAGGGTGGCGAAATCCGCCATTGGCGCGATTTTCTGGCGACTGTCGAACTTGCTCGGCCGATGCTGGGTATCAGCCAGAGCGCCTGGCGGGAAGCACTCGATGAGCTGGGCGAGCAGCATGCGGCAATCACGCTTGCGGCGATCTATCAGAAGGCCGAC------CAGATTGGATCGGCAGGCGGATACTTGCGTAACCTGACAGATCGAGCCCGTGATGGTAAATTCTCAACGTGGCCGATGATCATGGCACTGCTGCGGGCTAAACTTGATGCG
REPC_AGRRH/3-400 CAGACAGGAAGTGTAACGACGCCATTCGGGCGGCGGCCAATGACGCTTGCGCTTGTGCGGCGCCAGACGGCGCTGGCCGATATCAAACAAGGCAAGACAGCGGACAAGTGGAAGGTCTTTAGAGACGCGTCCGCGGCCATGGAACTACTTGGAATCCAGTCCAACAGTCTTGCCGTCCTTGATGCGCTATTGAGCTTTCACCCGGAAACGGAGTTGCGTCAGGAGGCACAGCTGATCGTCTTCCCGTCGAATGCTCAGCTTGCCCTTCGGGCGCATGGGATGGCTGGCGCGACTTTGCGTAGGCACATCGCCATGCTCGTGGAGTCAGGCTTGATCGTCCGGAAGGATAGCGCCAACGGAAAGCGTTACGCTCGTAAGGATGGCGCTGGTCAGATCGAGCGCGCGTTTGGCTTCGATTTGTCTCCGCTTCTCGCGCGGTCCGAAGAGCTAGCGATGATGGCACAGCAGGTGATGGCCGATCGAGCAGCATTCAGGATGGCCAAAGAAAGTCTGACGATTTGCCGACGGGACGTTCGGAAGCTAATTACGGCAGCT------ATGGAA---GAGGGAGCGGAGGGCGACTGGCAAGCTGTCGAGGAAGTCTATGTGGAACTTGTGGGTAGAATTCCACGCGCCCCGACGCTTGCTGAT------GTAGAGTCAATTCTCGAAGAGATGTGGATGCTCCAGGAAGAGATAATCAACCGGTTGGAAATTAGAGACAATTCAGAAAATAATAGCACCAATGCTGCCCAGAGCGAGCAGCACATACAGAATTCAAAACCCGAATCCGTTAATGAACTTGAACCTCGCTCTGAAAAG---------------------------------------------------------------GAGCAGGGCGCTAAGCCGAGTGAAATAGACCGGGCAAGGAGC...GAGCCGATAAAAGCGTTCCCCCTCGGGATGATCCTGAAAGCATGCCCGACCATTGGCAATTATGGGCCGAGCGGTGCGGTTGCTAGCTGGCGTGACCTCATGTCGGCTGCGGTGGTGGTTCGGTCTATGCTGGGGGTCAGCCCGTCGGCTTACCAAGACGCGTGTGAGGCAATGGGACCGGAGAATGCGGCAGCAGCGATGGCGTGCATTTTGGAGCGAGCGAAC------TTCATCAATTCGCCCGGGGGCTATCTCCGAGATCTGACACGGCGGAGCGAGCTCGGGAAGTTTTCACTTGGCCCGATGATAATGGCGCTCTTGAAGGCTAGCGGGCAGGGG
O33979_RHIET/2-397 CAGTCGGGGAATGTAGCGACGCCGTTCGGGCGGCGGCCAATGACGCTTGCGCTCGTGCGGCGCCAG---GCGGCAATGGAAATCAAGCATGGAAAAGCTGCCGATAAGTGGAAAGTGTTGAGAGACGCTTCCGCCGCGATGGAACTGCTCAAGATCCAGTCGAACAGTCTGGCTGTTCTTGACGCACTTTTGAGTTTTTATCCTGACAATGAGTTGCGTCAGGATGCACAATTGATTGTCTTCCCCTCGAATGCCCAACTGGCGCTTCGGGCGCATGCAATGGCGGGCGCAACGTTGCGGCGGCATATTGCCATTCTGGTGGAGTCGGGGTTGATCGTCCGTAAGGATAGCGCCAATGGCAAGCGCTTCGCCCGCAAGGGCGACGATGGCCAGATCGAGAATGCTTTTGGCTTCGACCTGTCGCCCCTCCTGGCGCGATCGGAAGAGTTGGCGATGTTGGCGCAAAGAGTGGCGGCCGAGAGAGCCTCGCTCAGGAAAGCCAAAGAGAGCCTTACAATTTGCCGGCGGGATGTTCGCAAACTTATTACTGCTGCA------ATGGTC---GAGGGCGCCGACGGCGATTGGAAGACGACCGAGGACATCTACATTGCGCTCGCGAGCAGAATTCCGCGCGTTCCGACCCTTGAAGGG------GTCACTAGCGTTCTCAATGAAATGGAGATGCTCCGTGAGGAAGTGCTTAATCGTTTGGAAAACCTCGAGAATGCTGAAAAAATTAGCACCAATGCTGCTCATATCGAGCAGCACATACAGAATTCAAAACCCGAATCCGTAAATGAATCTGAACCACGCTCCGAAAAG---------------------------------------------------------------GAGCAGGGGGCAAAGGCGAGCTTGAGCCTTCAGCCGAAGAAT...GAATCGCAAAGGGCGTTCCCCTTGGGATTGGTGCTCAAGGCGTGCCCGATGATCAGCGACTATGCACCGCGCGGC---GTGGGAAGCTGGCGAGATCTGATGTCTGCCGCTGTGGTGGTTCGATCTATGCTGGGGGTAAGCCCTTCCGCCTACCAGGATGCCTGCGAGGCGCTAGGACCGGAGAATGCTGCGGTGGCAATTGCGTGCATCCTGGAAAGGGCTAAC------TTCATCAACTCTCCTGGAGGCTATCTGCGGGATCTAACGCGCCGAAGTGAGCGCGGTGAATTCTCGCTTGGCCCGATGATAATGGCGTTGTTGAAGGCCAACGGGCAAGGC
Y4CI_RHISN/2-399 CAAGATGGAAGTGTGACGACGCCCTTCGGGCGGCGGTCGATGACGCTTGGCATGTTGGCAAGCCAATATATGTCGCGTGAACTCGAACCTGAAACATCGGCTGACAAGTGGAAGCTGTTTCGAGCGCTCTGCGAAGCTAAGCCGAAGCTCGGCATCAGCGAACGTGCGCTCTCTGTTATGAACGCACTTTTGAGCTTTTATCCCGAGACGACCTTGTCTGAGGAAAACGGCCTCATCGTGTTCCCCTCTAACATGCAGTTGTCGCTTCGTGCGCATGGCATGGCTGAAGCGACGTTGCGTCGCCACATCGCAGCGCTCGTCGACGCTGGCCTTCTGGCACGCCGGGATAGCCCAAATGGCAAACGCTACGCCCGCAAGGACGGAGACGGTTCGATCGATGAGGCCTATGGGTTTTCGTTGGCTCCGTTGCTGTCACGCGCACGCGAGATCGAGCAAATAGCTGCCTATGTCAAAATTGAGCGACTGCAATTGCGTAGACTTCGCGAGCGCCTGACGATCTGCCGGCGCGATATCGGTAAGCTGATTGAAGTCGCC------ATTGAG---GAGGGAGTGGACGGTAATTGGGACGGAATTCACCAGCACTACCGCAGCCTAGTAGCGACCATTCCTCGAGTGGCAACGGCCGCGACC------GTCGCCCCCATCCTCGAAGAGATGGAGATGTTGCGCGAGGAAATCTCCAACCTTCTGGAAATCAGGTTAAAAATCGAAAATTTGAGCGGCAATCCTGATCAAATTGAGCGGCACAAACAGAATTCACATCCCGAATCCACTAATGAATTTGAACCTAGCTCTCGAGAA---------------------------------------------------------------GAGCAGGGCGAAAGGCCGAGCCCAGCCATCGAACCGCAACGC...GAGCCGATGAAGGTGTTTCCGTTGGGGATGGTGTTGCGGGCTTGCCCAAGCATCTCAGATTATGGCCCCGGAGGCGTAGTTGCGAGCCCGCGTGACCTGATGCAGGCCGCAGTGGTCGTCCGCTCGATGCTCTGCGTCAGTCCGTCGGCCTACCAGGATGCCTGTGAGGTTATGGGGCCCGAGAACGCATCCGCTGTCATGGCCTGCATTCTGGAGCGGTCAGGG------CACATCAAATCGCCCGGCGGATATCTCCGCGACCTAACGTCTCGGGCAAAGCGGGGCGAGTTTTCGCCGGGGCCAGTGTTGATGGCACTGCTGAGGGCGCGCGGCGGAAGT
Q36691_RHILE/2-400 GAAACGGGTTATATCACGACGCCCTTTGGGCGGCGGCCGATGACGCTTGCTCTGGTGAAGCGTCAGGTTAAGACCGAGCAGGCAATAGCGGATGGCTCGGTCGACAAGTGGCGCGTGTTTCGGCACATAAGCGACGCCCGCTCACGCCTTGGCCTTCAAGATCGAGCCTTGGCGGTCTTGAATGCACTTTTAACATTCTTCCCAGTTGCTGAACTCAGCAATGAGAGGAACCTGGTCGTCTTTCCATCAAATGCTCAGCTATCAGCCCGCACAAACGGTATCGCTGGGACAACTCTGCGCAAGTGCCTCGGTTCGCTGGTGGAGGCCGGTGTAATCATCCGCAAGGATAGCCCTAACGGTAAGCGATATGCTCGAAAAGGCAAAGAAGGAAACATAGAGGACGCCTACGGCTTCAGTCTGGCACCGCTTCTTGCGCGCGCCGGCGAGTTTGCTAGCCTCGCCCAAGACGTGGCTGCTGAACAGCGCCGCTTCCGCATCACGAAAGACCGCCTCACGATCGTTCGGCGAGATGTCCGCAAGCTGATCACCGTCGGG------ATGGAA---GAGAACCTTGCCGGCGATTGGATTGCCGCGGAAACGTGCTTTGTCGAGATTGTGGGAAGGTTCGTTCGGCACCCGACGCTCCAGGAC------CTGATTTCGAGCCTCGACGAGATGAGCCTTCTTCACGAAGAAGTCTCCAGGATGCTGGAAATTAAAGAAGAAACCGCAAAAAGTGATGGCAATGCCATCCCGGACGGATGCCACATACAGAATTCAAATACCGAATCCTGCCATGAACTTGAACCCCGCTCCGAAAAG---------------------------------------------------------------AAGCAGGGCGAAAAGTCCGAGCCAAACAAGAAAACGGAGCGGaaaGACGAACCGGAAGCGTTTCCGTTGTCCATGGTGTTGCGTGCCTGCCCGGAGATCAACGCATTTGGCCCTGGTGGATCGATTGGAACGTGGCGCGAAATGATGTCAGCGGCGGTAACGGTTCGGTCCATGCTTGGCGTCAGCCCCTCTGCCTATCAGGAGGCATGCGAGGTGATGGGGCAGCGCGGAGCGGCGATAGCAATAGCTTGCATTTACCAGCGTGGCGGG------CACATCAACTCGGCGGGGGGATATCTTCGGGATCTAACGGGGAAGGGGGGACGAGGGGAGTTTTCACTTGGGCCAATGCTGTTTACGCAATTGCGGGCGAACTCGGGCACC
Q52629_PARVE/1-403 ATGGAGTACACACCGATTTCGCCGTTT---ATGCGGCCGATCTCGCACGCCCATCTGCGCGTGGTCGAGCGGCCTGAGGTATCTGTTCCGGGTAAGCCCATCAACAAGTGGGAACTCCTGCGCGAACTGTCCAAGGCGCAAGCGGCCTTTGGGGTCACAGAACGTGATTTGACGGTCATGCAGGGTCTTCTCAGCTTCTTCCCGGACGATGCGCTTGGCGGGAACGCTGAAATGGTCGTCTTCCCGTCCAACAAGGCGATCTGCGAGCGGCTGAATGGCATGCCCTGCTCCACCATGCGCAGGCACATTGCCCGCCTGGTGGACGCTGGCTTGCTCATGCGCCGCGATAGCCCCAACGGGAAGAGGTATGTCCGCAAGCATGGCGAAGAGCGCGTG------GCTTTCGGCTTCGATCTCTCGCCACTCTACTGCCGGTCCGAAGAGGTGGCACGGGCCGCAGAGGCCGTGCGTGAGGCCGAGGACCGTGTGCGGCGACTGCGGGAGGTCGTGAGCCTGATGCGGCGCGATCTCGCTGCCCTCGCGGAGTTCGGA------GAGGAGATCCAGCCCGGCCTTGGCCTGTGGGATCAGTTTCGCGACAAGGCTGTCCTCACAGCGCGCGCCCTGCGCCGCAAGCTCACGCTTGAGGAG------CTCTCCGCATATCGGACCGACCTTGAAGCCCTTCTCGATCGCGCACGCAACGTCATTGATGGC---CCTGAAACAGAAGAAATGAACACCAATGGTGCCAAGACTGAGCGCCACCATCATAATTCAAATAAAGAATCTATAGAT---CTTGAACCTGCCTTAGAAAAAGGCGGG---------------------------------GCGTCGGCCGCCGCGCCAGATGTTGAAACGGATGCACCTGGTGCTGACGTGGAAGAAGCGGACACA...AGACGCGTGCCAAAGATCCCGCTCCATCTGGTGATCGCTGGCTGCCCGTCGCTCAAAACCTTTTACCAAGGCGAC---ATCCGCCATTGGCATCAGCTTTTCGACGCGGCTTGCCATGTACGGCCCGCCATGGGGATCAGCGCGTCCGCTTGGGAAGAAGCGCAACGGTTCATGGGCCCCGAGCAGGCATCGATCGTTGTCGTCGCTATGCTGGAACGCTTTGCG------GACATCCGGTCGCCCGGTGGCTACCTCCGTGCGCTGACATCCAAGGCAGCGGCGGGCGAGTTCTCCTGTGGGCCGATGGTCATGGCGCTGATGTCCCGGCGAGATGCTGCA
Q07479_RHIME/3-422 AATACCCAAATTCATCAGCGGCCAATCGGCCGCAGGATAACGCCGCAGCGTGCGCAATTCCGGCGTTTGGCAGAGTCGGCGGATATCGGAACCGTGACGCGTGCCCAATTGGCCGTGCTTGCGCAAAGCCTGACATGCACAGGGCTAATCAACGGGACCGAAAGCCAC------CTATTGGTAGCGCTGATCAATACGGTTCCCGCTGATTCGTTCGACAGGTCCGGCCGTCTGATCGTATTCAAGTCGAACCAGCAACTGGCCTTCGAAATT---GGCCGGTCGGTCGGTCGCGTCAGCCGCATGCTATCCAGCCTCTTCGACGCTGGCCTGATCACGATGCAGGACAGCGGCAACTATAAGCGCTATCCCATCCGCAATGGCGACGGCGAGATCACGGACGGTTGCGGGATCGACCTTCGCATCTTGATCGTGCGATATGCCGAGCTTGACGAGCTCGTGAGACAGGCAAGGTCTCAGAAGAAAGCCCGCCGACGCGGCCTGCGGCGCTATCGTGGGGCGCTTCGCAATGCTCGCTATGCCCTCGCCGCCGCCGCGCGTCTCTCG---GAGGATTCTTTGAGCCGTCTCGGCGCCCGGATCGAGCGGGTGAGCAACATTGTCGGAATCGCCGGCAAGGCATCGAGTCGCGTGCTACGGCGGGCAACGGCTCTTCTGGAGTGGTTGATAGAGCGGATGATGCAGCTCCCGCGCCGATCGGCAGAAGCGCAGAAAACGCAAAATATGACATGCCCGTATGTCGAAAACGGCATGCACAAACAGATTACAACCCCTCATCCCTTTGACGATAGTAGTGACCAACGGCGTTCGGCTTACGCCGAACAACTCAGTTCGCCAAAGGCTGGCTCCGCCAGCAAATGGGCTTTTGAAGAAAGCCTGAGGCGGCGCCGGAGCGAAATCAACCAGCCACGGCGC...TTGCGGCACGCAATGGTGGCATTGCAAGACGTGCTTAGGGCGGTGCCAGCGTTGAAGACCTACGGGTTT------GCCCCCACCACTTGGGCCGACCTGGCGCGGGCGGTGCCGCTGATGTGCCGGTTTGCCGGGATCTCCGAGGATGCCCGCCGTCGCGCCGTGGAGCAGATGGGCGAGCAGCAAGCCGCCGTCGCCGTTGCCGTGACACTTGAGAAATACGACCGGCAGGAAGTCAACTCGCCGGGAGGATATTTGCGGGCTATGACGGACCGCGCTAGACGGGGCGAATTGCATCTCGCCCGCTCTGTCTTCGGGCTCGCTGCCCGAAATTCCATGGAG