EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03408 alignment
(4 sequences with 2994 bp)


ENV_SFV1/1-985 ATGACTCTGGAACAATGGCTCTTATGGAAGAAGATGAGTCAAGCACATCAAGCACTTGAAAATGTAACCACCTTGACTGAGGAACAGAAGCAACAAGTTATAATAGACATTCAGCATGAAGATGTTGTTCCTACTAGGATGGACAAATTGAAATATCTGGCCTATTCATGCTGCGCTACTAGCACACGTGTATTGTGCTGGATAGTGTTAGTTTGCGTCTTGCTATTAGTTGTATTTATATCCTGCTTTGTGACAATGTCCAGGATACAATGGAATAAGGATATTGCTGTTTTTGGTCCAGTCATTGACTGGAATGTTAGCCAACAAGCTGTGATTCAACAAATAAGAGCTAAAAGATTAGCAAGATCAATTAGGGTGGAACATGCTACTGAGACATATGTAGAGGTCAATATGACCAGTATACCTCAAGGGGTGTTATATGTGCCTCATCCAGAACCAATAATTCTCAAGGAGAGGGTTCTTGGTTTATCTCAGGTCATAATGATAAACTCTGAAAATATTGCTAATACTGCTAACCTTACTCAAGAAACTAAGGTACTGTTAGCAGACATGATTAATGAAGAGATGAATGATTTAGCTAATCAAATGATAGATTTTGAAATCCCATTAGGAGATCCCAGAGATCAAAAACAATACCAGCATCAAAAATGTTTTCAAGAATTTGCACATTGTTATTTAGTAAAATATAAAACTACTAAAGGATGGCCTAGTTCTACTGTTATAGCAGATCAATGCCCTTTGCCTGGTAACCAT---CCTACAGTACAATATGCACATCAAAATATATGGGATTATTATGTCCCCTTTGAACAAATTCGGCCAGAAGGATGGAACTCAAAAAGTTATTATGAAGATGCTAGAATAGGAGGGTTTTATATACCAAAATGGTTACGA---AATAATTCCTATACCCATGTCTTATTTTGTTCTGATCAAATTTATGGAAAATGGTATAATATTGATCTCACAGCCCAGGAGAGGGAAAATTTATTAGTCCAAAAATTAATTAAT------TTAGCTAAAGGAAATTCATCACAATTAAAGGATAGAGCTATGCCAGCTGAATGGGATAAACAAGGAAAAGCTGATCTATTTAGACAAATTAATACTTTAGATGTTTGTAATAGACCAGAAATGGTATTTTTGTTAAATTCCTCATATTATGAATTTTCCCTATGGGAAGGAGATTGTGGTTTTACCAGACAGAATGTTACACAGGCTAATTCCTTATGTAAAGATTTCTATAATAACTCAAAATGGCAAAAATTACATCCATATTCGTGTAGATTTTGGAGATATAAACAA------------GAGAAAGAAGAAACTAAATGTAGTAATGGTGAAAAGAAAAAATGTCTTTATTACCCACAATGGGATACTCCTGAAGCTTTATATGACTTTGGGTTCCTAGCATATTTAAATTCTTTTCCTTCTCCAATCTGTATAAAAAATCAGACTATAAGGGAACCTGAGTATGAAATCTCTTCTTTATACCTAGAATGCATGAATGCTTCAGACAGACATGGTATAGATAGTGCTTTATTAGCTTTGAAGACATTTTTAAACTTTACTGGTCAGTCTGTAAACGAAATGCCATTAGCTAGAGCCTTTGTAGGCCTTACTGACCCTAAATTTCCACCAACATATCCCAACATTACAAGGGAATCT------TCTGGTTGTAATAATAACAAAAGAAAAAGGAGAAGTGTT------AATAATTATGAAAGACTTAGATCTATGGGATATGCTTTAACTGGAGCTGTTCAAACTTTATCTCAAATATCTGATATTAATGATGAGAGGCTGCAACACGGAGTATATTTACTCCGGGATCATGTGGTAACCCTGATGGAAGCTGCCCTTCATGATGTTTCGATTATGGAAGGAATGTTAGCAATTCAACATGTGCATACTCATCTCAATCATCTCAAGACCATACTTTTGATGAGAAAGATTGATTGGACATTCATCAGAAGTGACTGGATTCAACAGCAATTACAGAAGACAGATGATGAAATGAAATTGATACGAAGAACTGCACGAAGTCTAGTCTACTATGTCACACAAACCTCCAGTTCTCCTACAGCTACTTCCTGGGAGATTGGAATATATTATGAAATAGTAATTCCTAAACATATATATTTAAATAATTGGCAAGTAATCAATGTAGGTCATTTATTGGAGTCAGCTGGTCATCTGACTCATGTAAAGGTTAAGCATCCTTATGAAATAATTAATAAGGAATGTAGTGACACTCAATATTTACATCTTGAGGAATGCATTAGAGAGGATTATGTGATTTGTGACATAGTACAAATAGTTCAACCATGTGGAAATGCAACAGAATTGAGTGATTGTCCAGTAGCAGCATTAAAGGTGAAGACTCCATATATTCAAGTGTCTCCCCTGAAGAATGGAAGTTATTTAGTTTTATCTAGTACTAAGGATTGTTCTATACCTGCATATGTACCTAGTGTGGTCACAGTCAATGAAACAGTTAAGTGCTTTGGAGTAGAGTTTCACAAACCACTTTATGCTGAAACAAAAACCAGC---TATGAACCACAAGTTCCGCATTTGAAGCTTCGTTTACCCCACTTGACTGGGATTATTGCCAGCTTGCAATCACTGGAAATAGAAGTTACTTCTACACAAGAGAATATAAAAGACCAGATCGAAAGGGCCAAAGCACAGCTTCTCCGGCTGGACATTCACGAAGGAGACTTTCCTGACTGGCTGAAACAAGTCGCCTCTGCAACCAGGGACGTTTGGCCTGCTGCAGCTTCCTTTATACAAGGAGTAGGTAACTTCTTATCTAATACTGCCCAGGGGATATTCGGCTCAGCGGTAAGCCTCCTATCCTATGCAAAACCTATTTTGATTGGAATAGGAGTTATACTGCTTATTGCCCTTCTTTTTAAGATAATATCATGGCTTCCTGGGAAGCTCAAGAAGAAT
ENV_FOAMV/1-985 ATGACACTGCAACAATGGATCATTTGGAAAAAAATGAATAAAGCGCATGAGGCACTTCAAAATACAACAACTGTGACTGAACAGCAGAAGGAACAAATTATACTGGACATTCAAAATGAAGAAGTACAACCAACTAGGAGAGATAAATTTAGATATCTGCTTTATACTTGTTGTGCTACTAGCTCAAGAGTATTGGCCTGGATGTTTTTAGTTTGTATATTGTTAATCATTGTTTTGGTTTCATGCTTTGTGACTATATCCAGAATACAATGGAATAAGGATATTCAGGTATTAGGACCTGTAATAGACTGGAATGTTACTCAAAGAGCTGTTTATCAACCCTTACAGACTAGAAGGATTGCACGTTCCCTTAGAATGCAGCATCCTGTTCCAAAATATGTGGAGGTAAATATGACTAGTATTCCACAAGGTGTATACTATGAACCCCATCCGGAACCCATAGTGGTGAAGGAGAGGGTCCTAGGTCTTTCTCAAATTCTGATGATTAATTCAGAAAACATTGCTAATAATGCTAATTTGACACAAGAAGTAAAGAAGTTGTTAACTGAAATGGTTAATGAAGAAATGCAAAGTTTGTCAGATGTAATGATTGACTTTGAAATTCCTTTAGGAGACCCTCGTGATCAAGAACAATATATACATAGAAAATGCTATCAAGAATTTGCAAATTGTTATTTAGTAAAATATAAAGAACCCAAACCGTGGCCTAAGGAGGGCCTTATAGCTGATCAATGCCCATTACCAGGTTACCAT---GCTGGATTAACCTATAATAGACAGTCTATTTGGGATTACTATATTAAAGTGGAGAGTATTAGACCTGCAAATTGGACAACAAAGAGTAAATATGGACAAGCTAGACTAGGAAGTTTTTATATTCCTAGCAGCCTGAGA---CAAATCAATGTTAGTCATGTACTATTCTGTAGTGATCAATTATATTCTAAATGGTATAATATAGAAAATACCATAGAACAAAACGAGCGGTTTCTGCTTAATAAACTAAATAAC------CTTACATCTGGA---ACCTCAGTATTGAAGAAAAGAGCTCTTCCGAAGGATTGGAGTTCTCAAGGTAAAAATGCTCTGTTTAGAGAAATCAATGTGTTAGATATCTGCAGTAAACCTGAATCTGTAATACTATTGAATACTTCATACTATTCCTTCTCTTTATGGGAAGGAGATTGTAATTTTACTAAAGATATGATTTCTCAGTTGGTTCCAGAATGTGATGGATTTTATAACAATTCTAAGTGGATGCATATGCATCCATATGCTTGTAGATTCTGGAGAAGTAAGAAG---------AATGAAAAAGAAGAAACTAAATGTAGAGATGGGGAAACTAAGAGATGTCTGTATTATCCTTTATGGGACAGTCCCGAATCTACATATGATTTTGGTTATTTAGCATACCAAAAGAATTTTCCTTCCCCTATCTGTATAGAACAACAGAAAATTAGAGATCAAGATTATGAAGTCTATTCTTTGTATCAAGAACGCAAAATAGCTTCTAAAGCATATGGAATTGATACAGTTTTATTCTCTCTAAAGAATTTTCTTAATTATACAGGAACTCCTGTAAATGAAATGCCTAATGCAAGAGCTTTTGTAGGCCTAATAGATCCCAAGTTTCCTCCTTCCTATCCCAATGTTACTAGGGAACAT---TATACTTCCTGTAATAATAGGAAAAGAAGAAGTGTTGAT---------AATAACTATGCTAAGTTAAGGTCTATGGGGTATGCACTTACAGGAGCAGTGCAAACCTTATCTCAAATATCAGATATTAATGATGAAAACTTACAGCAAGGAATATATTTATTAAGGGATCATGTAATAACCTTAATGGAAGCTACATTGCATGATATATCTGTTATGGAAGGAATGTTTGCTGTACAACATTTGCATACACATTTGAATCATTTGAAGACAATGCTTCTAGAAAGAAGAATAGACTGGACCTATATGTCTAGTACTTGGCTACAACAACAATTACAGAAATCTGATGATGAGATGAAAGTAATAAAGAGAATTGCTAGAAGTTTGGTATATTATGTTAAACAAACCCATAGTTCTCCCACAGCTACAGCCTGGGAGATTGGATTATATTATGAATTGGTTATACCTAAACATATTTACTTGAATAATTGGAATGTTGTCAATATAGGTCACTTAGTTAAATCAGCTGGACAATTGACTCATGTAACTATAGCTCATCCTTATGAAATAATCAATAAGGAATGTGTAGAGACTATATATCTGCATCTTGAGGACTGCACAAGACAAGATTATGTCATATGTGATGTGGTAAAGATAGTGCAGCCTTGTGGCAATAGCTCAGACACGAGTGATTGTCCTGTCTGGGCTGAAGCTGTAAAAGAACCATTTGTGCAAGTCAATCCTCTGAAAAACGGAAGTTATCTGGTTTTGGCAAGTTCCACAGACTGTCAGATCCCACCATATGTTCCTAGCATCGTGACTGTTAATGAAACAACGTCATGCTTTGGACTGGACTTTAAAAGGCCACTGGTTGCGGAAGAAAGATTGAGC---TTTGAGCCACGACTGCCAAATCTACAACTAAGATTACCACATTTGGTTGGAATTATTGCAAAAATCAAAGGGATAAAAATAGAAGTCACATCCTCTGGAGAAAGTATAAAAGAGCAGATTGAAAGAGCAAAAGCTGAGCTCCTTCGACTGGACATTCACGAGGGAGATACTCCTGCCTGGATACAACAGCTAGCTGCAGCAACAAAGGACGTCTGGCCAGCAGCAGCTTCTGCTCTACAAGGAATTGGTAACTTTTTATCTGGGACTGCCCAAGGAATATTTGGAACTGCCTTTAGTCTCTTGGGATACTTAAAGCCTATCCTAATAGGAGTAGGGGTCATTCTCTTGGTTATTCTTATATTTAAGATTGTATCATGGATTCCTACGAAAAAGAAGAATCAG
O41895_9RETR/5-988 ATGACGCTTCAGCAGTGGCTGCAGTGGAGATATAACCTAGAGACGACCAACCTCTTACAGATGAACCCTAAAATG------GAGAGTGTTTGCCTACCGGACTTTGATCCACCGGGTGATGAAGAAGTCTCCCTCAGAATA---AGGTGCAAATACTGGATCTATCTGTGCTGTGCCACCTCCACAAGAATAATGGCATGGATTGTGTTCATTCTCACAGTACTCAGCATATTGCTGATCTCTGTGTTGATAGCAGTATTTAGGTTACAATGGAAGGGAGCTATTGAGAGCCCAGGTCCCATTTTGGTGTGGAACAATAGTAATAGCATTAATGCTCAGCCTACCACACCTCCACACTATTCCCGACTGAGAAGGGCAATACACCTGGCACAAAAGCCTGTCCAGGTGAATTTTACTTCTATACCACAGGGCTTGTTCCTGGAACCTCACCCAAAACCCATAATTTCCAAGGAGAGGGTATTGGGACTTTCACAAGTAGTTATGGTGGACTCTAGCACTCTCACCCAGAAGTTGAACCTTGAAGGAGAAGCTAAATCACTCCTCATAAAAACCATAAATGAAGAACTGATCTCGTTACAAGATGTAGTCCTTAATTTTGACCTCCCCCTGGGGGATCCTCACACACAAGAAGAATATATAGCTAAGAGATGCTATCAACATTTTGGGCACTGCTACGTGGTACATATTCCAGGGGGAAAAGAATGGCCAACTCGGGAGATAATACAAGACCAGTGCCCTTTAAATAATTCATGGTTGACTGCTTTACATTATGACTATTTGCCAGCCTGGGATTATTATAATCAGCCTCCGCCG---AGGCAACTGTCATTGAAGGATTTCAGGAAGTATAATATTAGTAATAATGGTTCTAGATATGAAGCCTATAGGCTGCCCTTGCAAGACAAGATAGGGGCTGTAGCCTTCTGTAGCCCTACCCTATACTCCTCCTGGTGGAATTACACACAAAGTAGCAGAGAAAGAGAGGAATTATTCCGACGCAAGTTAGAAACC------TTCCTGAATCCACAGACTGGCTGCCTTAACCCCGAGGCACTCCCAGGAACCTGGCACACTCTAGGAAAAGGTGAATGGTTTAGAGATCTAACAACATATGACTTTTGCAAGAAACCAGAGGCCGTCTTTGGATTAAACAAGACTTATTATAGCTGGTCATTGTGGGAAGGAGACTGTGGAAGACAAGGAAATGACACTCAGGACTATCCACCAGAATGTCGGAAT---------TATGAGAAAAAGGATGGAGTACACGTCTATGGTTGCAGGTATTGGAGAACCTATTCTCAAACAGCCCATACCCCAGACAACCTGAGTTGTTATCTGTCAGAAGACTAT---TGTCTGTTCCAACCAAAATGGGACAGTGCTGAAATTAGATCTGATTTAGGTTATTTGGCCTATTTAGGAGCCTTTCCCAGCCCAATTTGTATTGAGGCAAGGAATTTAACTGATCAGGATTATAAGGTTACATCTATCTATGCTGAGTGTGTAAAGCAAGGGAAGCAATATGATATTATAGATGTAACACGTCAGCTGACAAGCAAGCTCACCCGAAGAGGGGTCTTCTTGGGCGACCTACCTGCAGACCGAGCCTTCTCCCTCCTGACTGACTTCTCGCTTCCAGCCAGTTATCAGAATAAAACGCAGGACGGAAGACGAAAAGTCTGTTCAAGTAAAAGAACGAGGAGAAGT---ATA------AATAACTGGAGAAGGCTCCAGATAACAGGACAATCAATGAATCAAGCCATTACCACGCTTTCTAAGTTGTCAGACTTGAATGATGAAAATCTAGCCGCAGGAATACATCTCCTCCAGGATCATATCGTCACCTTAATGGAAGCAACACTTCATGATGTGTCACTTTTAGGACACATGACTAGTATTCAACACTTACATACCCACTTAGCCACTTTTAAGAACCTGCTAATAGGAAATCGAGTGGACTGGTCAGTACTCGAAAATAAATGGATACAAGAAGAACTGAAATATACAGATGAGGTTATGAATGTAATTCGAAGAACTGCAAGAAGCATCACTTATGATGTCCAAAATGTGAAGAATACCAGTGACTCGACTATGTGGGAAATATATATTTACTATGAGCTTATACTACCAGAAAGAATTTGGATCCGTAATTGGCAAGTGGCCAATCTAGGACATTTGACCCACAATTCCGGATACCTTACCCATGTGACTATACATCATCCGTATGAGATTGTGAATCAAGACTGTGAAGAACTCACTTTTCTGCATTTAGTTGATTGTCACGAACAAGATTATTTAATATGTGAAGAGGTGATGGAAGTGGAACCTTGCGGCAACCTGACAGGA---TCTGATTGTCCAGTCTTGGCAGAAAATATACAGGCTCCTTATGTTTATTTACATCCTTTGAAAAATGGGAGTTATTTACTCATGGCTTCCCACACTGATTGTTCACTCCCCCCCTATGAACCTGTAGTAGTGACTGTGAATGACTCTCTCGAATGCTATGGTAAACCACTTAAAAGACCACTAACTTCTCATACTGAAATCAAGCTGTTTGCCCCACAAATACCACAACTGAGAGTCCGACTTCCTCATTTAGTTGGGATCATTGCCAAACTAAAGAGCTTAAAAATCAAGGTAACAAGCACTTGGGAATCTATAAAAGACCAGATACACAGATCAGAACAAGAGCTACTTCGGTTGGATCTCCACGAAGGAGATTACTCAGACTGGATCCTGCAACTTGGAAACGCCCTAGAGGACGTCTGGCCTGTAGCTGCGTCTGCTGTGAGTACAATCGGGACCTTACTGGAGAAAGCTGCAGGAACTCTCTTCGGGAATGTTTTCAGCATACTAGCCTATGCTAAACCGGTCATTATTGGGATAATACTTATCATTTTACTTTTGTTAGTCATCAGAATATTGAGATGGCTAGCGGTGGAACGCCGGAGAAAG
P90478_9RETR/7-979 ATGACCTTGAAGGAATGGATGGAATGGAAT------------GCTCACAAACAACTACAGAAACTTCAGTTGACTCATCCTGAGTTACATGTTGACATACCTGAAGATATTCATTCAGTACCAGAGAAGGTACCTTTGAAAATGAGGATGCGATATAGATGTTATACTCTGTGTGCTACTTCTACTAGAATAATGTTTTGGATACTATTCTTTCTTCTATGTTTTTCAATAGTTACTTTAAGTACAATTATAAGTATTCTTAGATATCAATGGAAAGAAGCAATAACACATCCTGGCCCAGTTTTAAGTTGGCAGGTGACTAATTCACATGTAACAATGGGAGGAAATACTTCCTCTTCCTCCAGACGGAGACGTGATATACAATACCACAAACTTCCCGTAGAGGTTAACATCTCAGGGATCCCACAAGGTCTTTTCTTTGCACCTCAACCAAAACCTATACTTCACAAAGAAAGAACTTTAGGTCTTTCTCAAGTGATTCTTATTGATTCCGATACTATTACTCAAGGT---CATATTAAA---CAACAGAAAGCATATTTAGTCTCAACTATTAATGAAGAAATGGAACAATTAAAAAAGACAGTATTACCTTTTGATTTACCTACCAAGGATCCTTTAACTCAAAAAGAATATATAGAGAAGAGGTGCTTTCAACATTTTGGACATTGTTATGTTATTGAGTATGGAAGTCCTAGAAAATGGCCATTTGATGATTTAATACAAGATCAATGCCCCTTACCTGTGATATACAGTAATGGGCCTCGATATAGAAATCATACTATCTGGTCTTTGTATATATATCAACCTTTTTCAGTGCCCAAAAATTGGTCTAACCCA------TATGGAGATGCCAGGATTGGAAGTTTTTATGTTCCAAAGGAATTTAAA---GAGAATGCT---ACTCATGGAATATTCTGTTCTGACCAATTATATGGAGAATGGTATGACAGGACTTTACCTTCTCAGACATTGCAAGAACTAGCAAAAACCTTTTTAATGAGGATATTATTAAAGAGAAGAAATGGAAACAAATTAAATGAATCATCCTTGGCTCCTACTTTGTCCTCTAAGGGACAAAAGCTCCTCTTCAGAGATTTGGTTCCATATGATAGTTGCAACATACCTAAAGCAGTACTTCTCTTAAACAGAACTTATTGGCCATTTTCCTTGTGGGAAGGCGATTGTGGGATATTTCAGACAAATATCACAGAACATGCTAGC---TGTAAGAAGTTC---------AATCGAACTCAGACTTCGCATCCTTATGCTTGCACTTTCTGGAGACAATATTTA------------GGAAATGCCTCAATAAAATGCGTGGAT---GACTCAGCACGATGTTATTATAGTCCTGCTTACACAGGAGTTGAAAATAGGGAAGATTTTGGATGGCAAGCATATAATGACAATTTTCCCTCACCTGTATGTATTAAAGAGATACCAATTATTAAAAAGAATTATAAAGTATCCTCTGTCCTAGCTGAATGCATAAATAAGGCAAAACAATATGGAATCAAAGAAGTAATAGATAAATTGGAAAATTTG------TTCTCTACCAAGCATGTGTTGCCTGAAGATACTTTTAAACCTTATAATAATTTTACATGGCCTAAATATGAAAAACAAAATAAACAACAAAAAACCTCTTGT------GAAGGAAGCAAAAAC---AAAAGACAAAGAAGGTCCGTAAGTACAGAAAACCTAAGAAGAATGCAAGAGGCAGGCTTAGGCCTGGCCAATGCAATTACCACTGTGGCCAAGATTTCTGACCTGAATGATCAGAAATTAGCCAAGGGAGTACATTTGCTTAGAGATCATGTTGTCACTCTAATGGAAGCCAATTTGGATGATATTGTGTCCCTAGGAGAGGGAATACAAATAGAACATATACACAATCACTTAACCTCTTTGAAATTGCTTACCTTGGAAAATAGAATTGACTGGAGGTTTATAAATGACTCATGGATTCAGGAAGAATTAGGTGTTTCAGACAATATAATGAAAGTAATAAGGAAAACTGCAAGGTGTATTCCTTACAATGTCAAACAAACAAGGAATCTAAACACTTCTACTGCATGGGAAATATATTTATATTATGAGATTATCATTCCTACCACTATATATACACAGAATTGGAATATAAAGAATCTAGGTCACCTTGTAAGGAATGCAGGATATTTGTCTAAGGTGTGGATCCAACAACCATTTGAAGTATTAAACCAGGAATGTGGAACAAATATATATTTACATATGGAAGAATGTGTTGACCAAGACTATATAATATGTGAAGAAGTAATAGAATTTCCTCCTTGTGGAAATGGAACTGGT---TCAGACTGCCCAGTGCTAACTAAACCTCTTACAGATGAATACTTGGAAATTGAACCCCTGAAGAATGGGAGCTATTTGGTTTTATCAAGTACTACAGACTGTGGCATACCAGCTTACGTGCCTGTGGTTATAACAGTGAATGACACAATCAGCTGTTTTGATAAAGAGTTTAAAAGGCCACTTAAACAGGAACTAAGAGTAACAAAATATGCACCATCTGTTCCTCAATTGGAACTAAGAGTTCCTCGGCTAACAAGCTTGATTGCAAAAATAAAAGGAATTCAAATAGAAATCACTAGCAGCTGGGAAACTATAAAAGAGCAAGTTGCAAGAGCTAAGGCAGAGCTTCTACGCTTGGACCTTCACGAAGGAGACTATCCAGAGTGGCTGCAGCTCCTTGGAGAAGCAACTAAAGACGTTTGGCCTGCAATCTCCAACTTCGTTTCTGGAGTAGGTAATTTCATAAAGGACACTGCTGGAGGTATTTTTGGAACTGCCTTTAGTTTTCTGGGATATGTAAAACCTGTACTGTTGGGATTCGTGATCATATTTTGCATAATTTTGATTATAAAGATCATAGGATGGCTGCAAAATACCCGGAAGAAGGAC