EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03390 alignment
(11 sequences with 1275 bp)


O07032_LACLA/8-420 AAAATATCGGGAATTAGTCTTCCCTTATATGCCTTTTTCGTAGCTGTCATCATAGTTGTAACACTATTAGGAAAACTTCCACTTGATATGGTAGGGTTAACTCTCCTACTTGTAACATTAGGCCACCTATTATACTTCATAGGAGAAAAATTCCCTATTATGAATTCATACTTAGGTGGGGGATCTGTTTTCACTTTAATTGGTGCTACTCTATTATCTTTCTTCCACATTGTTCCTTCAAATGTTATTGGAGCAGTTTCCAATTTTATGGGTGGAAAATTTGGATTTCTTGATTTTTATATAGCTGCACTTATCTGTGGATCTATTTTAGGAATGAACAGAAATCTTTTGGTTAAAGCTTCCAAGAAATTTATTCCGATTGCTTTAATCACTATGGTTATTGGTTTCTTCTCAGTAGGTCTTGTAGGAATGCTTATTGGTAATGGATTTGCTGATTCTGTAATGTATGTTTCTATGCCAATGATGTCAGGTGGTATGGGAGCCGGAATTACTCCACTCTCTCAAATCTATGCAGCCGGATTGGCTCATGGAAACCAAGCAGCTATCTTCTCTCAACTTGCTCCAGCAGTTACTTTTGGTAATATTCTTGCGATTATTGGTGCCTTATCTATCGCTAAAGTATTCAACAAA---TCTAAATATAATGGACATGGGACTCTTGTTGCAGCAACTAAAGAAGAGTTG---------GCTAAA------CCTAAAATAAAATTAGATGCTCAACAAATCGGAACAGGAATGCTCTTTGCCTTTGCTCTTTTGATGGCTGGTGACATCTTGAACAAATTCTTCCCTAAT------------------ATTCATCAATATGCATTTATGATTATTATTGTATTTATCTTGAAAGCAACAAATACTGTTCCTAAAGATTTAGAAGAATCTGTTGTAATGTTTAACCAAGTGATTATGACAAACCTTACTCATGCTGTTTTGGCAGGTATTGGTCTTGCTTTGATTGACTTGAATACTCTTGCTTCAGCATTTACATGGCAATTTGTTGTACTTTGCTTGACAAGTGTTGTTGTAATGGGACTTGCTAGCTGGTTCTTGGCTCGCCTCTTTGGACTTTATCCAGTCGAAACTGCCATTGGTGCAGGGATGATCAATAATTCTATGGGTGGAACAGGTAACATTGCTGTCTTGTCTGCATCAGATAGAATGGAAATGATTGCTTTTGCACAGATGGCTAATAGACTCTGTGGTGCAATTGTCCTTATCTTCGGTGGAATTCTT
Q48769_LEUME/26-438 CGTATTAGTGGAATCGGATTGGTTCGTTACGCATTTATGGCAGTTTTGTTGATTATTGCGATTTCAACAAAGACGCTGCCAAATACAATGATTGGTGCAATTTTTGCATTGGTCCTAATGGGACACGTGTTTTACTACCTTGGTGCTCACTTACCAATCTTCCGATCATATTTGGGTGGTGGGTCAGTTTTCACCATTTTGTTAACAGCCATTTTGGTTGCAACGAATGTGATGCCAAAATATGTTGTTACGACAGCTTCAGGATTTATTAATGGC---ATGGACTTTTTGGGTCTTTATATCGTTTCTTTGATTGCCTCATCTTTGTTTAAAATGGATCGTAAGATGTTGTTGAAGGCTGCAGTTCGATTCTTGCCGGTCGCATTCATTTCAATGGCATTGACGGCTGTTGTAATTGGAATTGTTGGTGTTATTATTGGTGTCGGTTTTAACTACGCTATTTTGTACATTGCTATGCCAATCATGGCTGGTGGAGTTGGTGCTGGTATTGTGCCACTTTCTGGTATCTATGCACACGCGATGGGCGTTGGATCC---GCAGGAATTTTGTCTAAGCTATTCCCAACGGTTATCCTCGGGAATCTGCTAGCAATTATTAGTGCTGGACTTATCTCACGTATCTTCAAGGAC---AGCAAAGGAAATGGTCACGGTGAAATTCTACGTGGTGAACGCGAAGATGCT---------GCTGCTGCTGCTGAGGAGATTAAGCCTGATTACGTGCAACTAGGTGTCGGATTGATCATTGCGGTTATGTTCTTTATGATTGGTACGATGTTGAATAAGGTGTTCCCTGGC------------------ATCAACGCATATGCATTTATTATTTTGAGCATCGTTTTGACAAAGGCATTTGGCTTGTTGCCAAAGTACTATGAAGACAGTGTAATTATGTTCGGTCAAGTTATCGTTAAGAACATGACGCACGCATTGCTTGCTGGTGTTGGATTGTCTTTGCTTGATATGCACGTTTTGTTGGCAGCTTTGTCATGGCAATTTGTTGTCTTGTGCTTGGTAAGTATTGTCGCAATTTCATTGATCAGTGCAACGCTTGGAAAGTTGTTTGGATTGTATCCGGTTGAAGCTGCTATTACAGCAGGGTTGGCCAACAACTCGATGGGTGGTACTGGAAACGTTGCCGTATTGGCTGCATCAGAACGCATGAACTTGATTGCGTTTGCGCAAATGGGTAATCGAATCGGTGGTGCCTTGATTCTGGTTGTTGCTGGAATTCTA
Q48613_LEULA/26-436 CGTATTAGTGGAATCGGATTGGTTGCTTACGCATTTATGGCAGTTTTGTTGATTATTGCGATTTCAACAAAGACGCTGCCAAATACAATGATTGGTGCAATTTTTGCATTGGTCCTAATGGGACACGTGTTTTACTACCTTGGTGCTCACTTACCAATCTTCCGATCATATTTGGGTGGTGGGTCAGTTTTCACCATTTTGTTAACAGCCATTTTGGTTGCAACGAATGTGATGCCAAAATATGTTGTTACGACAGCTTCAGGATTTATTAATGGC---ATGGACTTTTTGGGTCTTTATATCGTTTCTTTGATTGCCTCATCTTTGTTTAAAATGGATCGTAAGATGTTGTTGAAGGCTGCAGTTCGATTCTTGCCGGTCGCATTCATTTCAATGGCATTGACGGCTGTTGTAATTGGAATTGTTGGTGTTATTATTGGTGTCGGTTTTAACTACGCTATTTTGTACATTGCTATGCCAATCATGGCTGGTGGAGTTGGTGCTGGTATTGTGCCACTTTCTGGTATCTATGCACACGCGATGGGCGTTGGATCC---GCAGGAATTTTGTCTAAGCTATTCCCAACAGTTATCCTCGGGAATCTGCTAGCTATTATTAGTGCTGGACTTATCTCACGTATCTTCAAGGAC---AGCAAAGGAAATGGTCACGGTGAAATTCTACGTGGTGAACGCGAAGATGCT---------GCTGCT------GAGGAGATTAAGCCTGATTACGTGCAACTAGGTGTCGGATTGATCATTGCGGTTATGTTCTTTATGATTGGTACGATGTTGAATAAGGTGTTCCCTGGC------------------ATCAACGCATATGCATTTATTATTTTGAGCATCGTTTTGACAAAGGCATTTGGCTTGTTGCCAAAGTACTATGAAGACAGTGTAATTATGTTCGGTCAAGTTATCGTTAAGAACATGACGCACGCATTGCTTGCTGGTGTTGGATTGTCTTTGCTTGATATGCACGTTTTGTTGGCAGCTTTGTCATGGCAATTTGTTGTCTTGTGCTTGGTAAGTATTGTCGCAATTTCATTGATCAGTGCAACGCTTGGAAAGTTGTTTGGATTGTATCCGGTTGAAGCTGCTATTACAGCAGGGTTGGCCAACAACTCGATGGGTGGTACTGGAAACGTTGCCGTATTGGCCGCATCAGAACGCATGAACTTGATTGCGTTTGCGCAAATGGGTAATCGAATCGGTGGTGCCTTGATTCTGGTTGTTGCTGGAATTCTA
Q9RLT1_WEIPA/26-437 CGTATTAGTGGAATCGGATTGATTGCTTACGCATTTATGGCAGTTTTGTTGATTATTGCGATTTCAACAAAGACGCTGCCAAATACAATGATTGGTGCAATTTTTGCATTGGTCCTAATGGGACACGTGTTTTACTACCTTGGTGCTCACTTACCAATCTTCCGATCATATTTGGGTGGTGGGTCAGTTTTCACCATTTTGTTAACAGCCATTTTGGTTGCAACGAATGTGATGCCAAAATATGTTGTTACGACAGCTTCAGGATTTATTAATGGC---ATGGACTTTTTGGGTCTTTATATCGTTTCTTTGATTGCCTCATCTTTGTTTAAAATGGATCGTAAGATGTTGTTGAAGGCTGCAGTTCGATTCTTGCCGGTCGCATTCATTTCAATGGCATTGACGGCTGTTGTAATTGGAATTGTTGGTGTTATTATTGGTGTCGGTTTTAACTACGCTATTTTGTACATTGCTATGCCAATCATGGCTGGTGGAGTTGGTGCTGGTATTGTGCCACTTTCTGGTATCTATGCACACGCGATGGGCGTTGGATCC---GCAGGAATTTTGTCTAAGCTATTCCCAACGGTTATCCTCGGGAATCTGCTAGCAATTATTAGTGCTGGACTTATCTCACGTATCTTCAAGGAC---AGCAAAGGAAATGGTCACGGTGAAATTCTACGTGGTGAACGCGAAGAAGCT---------GCTGCTGCT---GAGGAGATTAAGCCTGATTACGTGCAACTAGGTGTCGGATTGATGATTGCGGTTATGTTCTTTATGATTGGTACGATGTTGAATAAGGTGTTCCCTGGC------------------ATCAACGCATATGCATTTATTATTTTGAGCATCGTTTTGACAAAGGCATTTGGCTTGTTGCCAAAGTACTATGAAGACAGTGTAATTATGTTCGGTCAAGTTATCGTTAAGAACATGACGCACGCATTGCTTGCTGGTGTTGGATTGTCTTTGCTTGATATGCACGTTTTGTTGGCAGCTTTGTCATGGCAATTTGTTGTCTTGTGCTTGGTAAGTATTGTCGCAATTTCATTGATCAGTGCAACGCTTGGAAAGTTGTTTGGATTGTATCCGGTTGAAGCTGCTATTACAGCAGGGTTGGCCAACAACTCGATGGGTGGTACTGGAAACGTTGCCGTATTGGCCGCATCAGAACGCATGAACTTGATTGCGTTTGCGCAAATGGGTAATCGAATCGGTGGTGCCTTGATTCTGGTTGTTGCTGGAATTCTA
CITN_LACLA/26-437 CGTATTAGTGGAATCGGATTGATTGCTTACGCATTTATGGCAGTTTTGTTGATTATTGCGATTTCAACAAAGACGCTGCCAAATACAATGATTGGTGCAATTTTTGCATTGGTCCTAATGGGACACGTGTTTTACTACCTTGGTGCTCACTTACCAATCTTCCGCTCATATTTGGGTGGCGGATCAGTTTTCACCATTTTGTTAACAGCCATTTTGGTTGCAACGAATGTGATACCAAAATATGTTGTTACGACAGCTTCAGGATTTATTAATGGC---ATGGACTTTTTGGGTCTTTATATCGTTTCTTTGATTGCCTCATCTTTGTTTAAAATGGATCGTAAGATGTTGTTGAAGGCTGCAGTTCGATTCTTGCCAGTCGCATTCATTTCAATGGCATTGACGGCTGTTGTAATTGGAATTGTTGGTGTTATTATTGGTGTCGGTTTTAACTACGCTATTTTGTACATTGCTATGCCAATCATGGCTGGTGGAGTTGGTGCTGGTATTGTGCCACTTTCTGGTATCTATGCACACGCGATGGGCGTTGGATCC---GCAGGAATTTTGTCTAAGCTATTCCCAACAGTTATCCTCGGGAATCTGCTAGCGATTATTAGTGCTGGACTTATCTCACGTATCTTCAAGGAC---AGCAAAGGAAATGGTCACGGTGAAATTCTACGTGGTGAACGCGAAAAATCT---------GCTGCTGCT---GAGGAGATTAAGCCTGATTACGTGCAACTAGGTGTCGGATTGATCATTGCGGTTATGTTCTTTATGATTGGTACGATGTTGAATAAGGTGTTCCCTGGC------------------ATCAACGCATATGCATTTATTATTTTGAGCATCGTTTTGACAAAGGCATTTGGCTTGTTGCCAAAGTACTATGAAGACAGTGTAATTATGTTCGGTCAAGTTATTGTTAAGAACATGACGCACGCATTGCTTGCTGGTGTTGGATTGTCTTTGCTTGATATGCACGTTTTGTTGGCAGCTTTGTCATGGCAATTTGTTGTCTTGTGCTTGGTAAGTATTGTCGCAATTTCATTGATCAGTGCAACGCTTGGAAAGTTGTTTGGATTGTATCCGGTTGAAGCTGCTATTACAGCAGGGTTGGCCAACAACTCGATGGGTGGTACAGGAAACGTTGCCGTATTGGCCGCATCAGAACGCATGAACTTGATTGCGTTTGCGCAAATGGGTAATCGAATCGGTGGTGCCTTGATTCTGGTTGTTGCTGGAATTTTA
CIMH_BACSU/32-445 AAAGTAGGCATCATACCGCTTCCTGTGTATGCCTTGCTGTTTATATTAATCACTGTTTTTGTTATGCATCACGATGTAAAAAGTGACATTTTGACATCCATTGCCGTCATGGCGTTTTTCGGGTTTACCTTTGCCCAAATCGGCAAATCGATACCGATTGTTCGTTCT---ATCGGCGGCCCGGCCATCCTAGCTACTTTTATTCCGTCCGCTGTCGTGTACTATCACCTGCTGCCTAATGATATCGTCAAATCCACCACAGAATTTACAGAAAAC---TCAAACTTTCTATATTTGTTTATCGCCGGTATTGTCGTCGGAAGCATTCTCGGCATGAAAAGAGAAACACTCGTAAAAGCATTCATGAAAATCTTTATTCCGCTTATTGTCGGTTCTGTCACAGCCGCTATTGTCGGACTGGCTGTCGGGACATTGCTCGGACTCGGATTTCAGCATACCCTGCTGTACATTGTCATTCCGATCATGGCTGGAGGAGTCGGAGAAGGCGCTATCCCGCTGTCCATCGGATATTCTGACATCATGCCCATTTCTCAA---GGGGAAGCGTTTGCACTTGTTCTGCCATCGATTATGCTGGGCAGCTTGTGCGCGATTATTCTAGCGGGATTGCTGAACCGAATCGGAAAGAAAAAACCGGAATGGACAGGCAACGGCAAAGTGGACCGCTCCGAAGAAGAGTCCCCTGCGCTGGAGGAATCTCAAAGCGGACAGCAAATGTTCAACCTTTCTTTATTTGCGTCAGGCGGTATCCTTGCTGTTTCTTTATACTTAGTCGGCATGCTCGCTCACGATTTTTTCGGT---------------------TTTCCGGCACCCGTTGCCATGCTGTTACTGGCTGTTCTAATCAAGCTGTTCAGATTGGTGCCTGCCTCAATTGAAAATGGCGCGTTTGGAGTGTCCCGCTTCTTTTCAACAGCTGTGACCTACCCGCTTCTCTTTGCGATTGGGGTATCCATGACGCCGTGGGACAAGCTTGTCGCCGCTTTTAACCTCAGCAATATTATCACGATTCTGTCTGTCGTTGTGACCATGATGGCCGTTGGCTTCTTCACTGGAAAATGGCTGAACATGTATCCGATTGAAACCGCCATTATTAATGCA---TGCCATTCTGGGCAAGGCGGCACGGGTGACGTTGCCATTTTAAGCGCCGCTGAAAGGCTTGAGCTAATGCCTTTCGCCCAGGTGTCTACCCGCATCGGGGGCGCGATTACAGTATCCTTAACCTTATTGCTG
Q53787_STRBO/23-436 AGGATTGGTTCGGTTACGTTACCTGTTTATCTTGTAACAGCTAGCATTATTCTTGTTACGGCTCTATTAGAACAACTACCAGTCAATATGTTAGGTGGTTTTGCCGTAATTTTAACAATGGGTTGGTTACTTGGAACAATTGGTGGAAATATTCCTATTTTGAAACAT---TTTGGCGGTCCCGCAATTTTATCTTTATTAGTACCATCAATTATGGTCTTTTTCAATTTACTCAACCAAAATGTCTTAGACTCAACAGATATTTTAATGAAACAA---GCAAACTTTCTCTATTTCTATATTGCTTGTTTAGTTTGTGGAAGTATCCTTGGAATGAATCGCAAAATTTTAGTCCAAGGTTTAATGCGCATGATTGTCCCGATGGCATTAGGAATGATTTTAGCAATGGGCGTTGGGACCCTTGTTGGAACACTGTTAGGTCTCGGTTGGAAACATAGCCTTTTCTATATCGTCACTCCTGTTTTAGCTGGTGGAATCGGTGAAGGTATTCTTCCTTTATCCCTTGGTTATAGTGCCATTACTGGGTTGCCAAGT---GAACAATTAGTGGGGCAATTAATTCCCGCAACCATTATTGGTAATTTTTTTGCTATCATGTGTTCAGGTTTACTTAGTCGTTTAGGAGAAAAACGCCCTGAACTTTCTGGACAAGGTCAGTTGATTAAAATTACCAATTCAGATGATTTAAGTGATGCTTTAGAAGAAGACAAAGCACCAATTGATGTAAAATTAATGGGCGCTGGTGTTTTAATTGCATGTACCTTATTTATTACAGGCGGTTTATTGCAACACTTAACAGGC---------------------TTTCCTGGTCCTGTTTTGATGATTGTTGTCGCAGCCTTTTTAAAATACTTAAACGTAGTACCGAAAGAAACCCAACGCGGATCAAAACAGCTTTATAAATTTATCTCTGGCAATTTTACGTTCCCGTTAATGGTCGGCTTAGGTATGTTATATATTCCTTTAAAAGATGTCGTAGGAATGCTTAGCTGGCAATATTTTGTTGTGGTAATTAGTGTCGTTTTCACTGTTATTGCTACAGGATTTTTCGTTTCACGCTTCATGAATATGAATCCCGTCGAGGCTGCCATTGTCTCCGCT---TGTCAGAGTGGTATGGGTGGGACTGGCGATGTGGCTATTTTAAGTACAGCCAATCGAATGACCTTAATGCCGTTTGCACAAGTTGCGACACGTTTAGGCGGTGCCATTACAGTAATAACAATGACTGCTATT
MAEN_BACSU/30-442 GAAATCGGTGTGATTCCTTTGCCATTATACACAGTATTAGCTGTTATTATTATTCTTGCAGCATATTACAATGAGCTGCCGGCAAATATGCTTGGCGGGTTTGCCATCATTATGATTCTTGGTGTGTTTCTCGGAGACATAGGCCAACGCATACCGATATTGAAGGAT---ATTGGCGGCCCTGCTATTTTATCTTTGTTTGTTCCTTCATTTTTAGTCTTTTACAATGTACTGAATTCAACATCTTTAGACGCTGTAACCAACTTGATGAAAACG---TCTAACTTCCTTTATTTCTATATCGCTTGCCTTGTTGTGGGAAGTATCCTCGGTATGAACAGAATTGTTTTAATACAGGGGTTTATCAGAATGTTCGTTCCACTGGTTGCAGGAACGATCGCGGCCGTTGCAGCCGGCATCCTTGTCGGATTTATTTTTGGCTATAGTGCCTATGATTCCTTTTTCTTTGTTGTTGTCCCGATTATTGCCGGGGGAATAGGTGAAGGGATTTTGCCGCTTTCAATCGCCTATTCACAAATACTGGGCTCATCCGCC---GATGTATTTGTGTCTCAGCTGGTGCCAGCCGCAATTATAGGAAACGTTTTTGCTATCATATGTGCAGCCTTAATGAAAAAGCTTGGCGACAAGCGTCCAGATCTAAATGGGAACGGACGTCTCGTAAAATCTAAAAAAGCAAATGAGATTTTCAATCAA---AAAGAAGCCGAAGCAAAAATTGATTTTAAACTAATGGGAGCAGGAGTTCTGCTCGCGTGTACATTCTTTATTTTTGGCGGGTTATTGGAGAAATTCATCTTC---------------------ATCCCGGGCGCGATCTTAATGATTATTTCAGCTGCGGCTGTCAAGTATGCAAATATTCTTCCGAAAAAAATGGAAGAAGGCGCTTACCAGCTTTATAAGTTTATTTCTTCAAGCTTTACATGGCCGCTGATGGTCGGTCTCGGCATCCTCTTTATTCCGTTGGATGACGTAGCGTCTGTGATTTCTATACCGTTTGTCATCATCTGTATTTCAGTTGTTATCGCGATGATTGGTTCTGGATATTTCGTAGGCAAGCTGATGAACATGTATCCGGTTGAATCCGCAATCGTTACCTGC---TGCCACAGCGGTCTCGGCGGAACGGGTGATGTTGCCATTTTATCGGCATCAGGAAGAATGGGCCTTATGCCGTTTGCCCAAATTTCAACCCGTCTCGGCGGTGCAGGCACAGTTATTTGCGCGACAGTGCTG
CITN_SALDU/22-441 AAAATCTTTGGTATGCCGCTACCGCTTTATGCTTTTGCATTAATTACTTTATTACTGTCTCATTTCTATAACGCTATACCGACTGACTTAGTCGGTGGTTTTGCTCTTATGTTTGTTATGGGGGCCATTTTTGGTGAAATCGGCAAACGTTTACCGATCTTCAATAAATATATTGGTGGCGCACCGGTTATGATATTTCTGGTTGCAGCTTATTTTGTCTATGCTGGCATATTTACGCAGAAAGAAATTGATGCGATCAGCAACGTAATGGATAAA---AGCAACTTCCTTAACCTGTTTATCGCAGTGTTGATCACAGGCGCGATCCTGTCGGTAAACCGTAAGCTGCTATTAAAATCACTGCTGGGCTATATCCCAACCATCCTCGCCGGGATTGTCGGCGCGTCCCTTTTCGGTATCGTCATTGGTCTGTGCTTCGGTATCCCGGTCGACCGTATCATGATGCTGTACGTTCTGCCGATTATGGGCGGTGGTAACGGCGCGGGCGCCGTGCCTCTGTCTGAAATTTATCACTCGGTTACCGGACGTTCTCGC---GAAGAGTATTACTCAACGGCTATTGCTATTCTGACCATTGCGAATATCTTCGCCATTATTTTCGCCGCCCTCCTCGATATGATAGGCAAAAAATACACCTGGCTTAGCGGTGAAGGTGAGTTGGTTCGTAAGGCTTCCTTCAAAACC---------GAAGATGATGAAAAGGCCGGTCAGATTACCCATCGTGAAACGGCGGTTGGCATGGTGTTATCCACCACCTGCTTCCTGCTGGCCTATGTCGTTGCCAAGAAAATTCTGCCAAGCATCGGCGGCGTCTCTATTCACTACTTCGCCTGGATGGTTCTGATTGTTGCTGCGCTGAACGCATCAGGTCTTTGCTCACCGGAGATTAAAGCCGGGGCGAAACGTCTTTCTGACTTCTTCTCCAAACAGCTACTGTGGGTGTTGATGGTAGGTGTGGGTGTTTGCTACACCGATCTGCAAGAGATCATCGATGCCCTGACGTTCGCGAACGTCGTTATCGCCGCAATCATTGTGGTCGGCGCAGTCGTTGGCGCAGCTATCGGGGGCTGGTTGATTGGCTTCTACCCGATTGAATCATCCATTACTGCGGGTCTTTGTATGGCCAACCGCGGCGGCTCCGGCGATCTGGAAGTGCTCTCCGCCTGTAACCGTATGAACCTCATTTCATATGCACAAATTTCCTCTCGTCTGGGCGGCGGTATTGTGCTGGTTATCGCTAGCATCGTG
CITN_SALTY/22-441 AAAATCTTTGGTATGCCGCTACCGCTTTATGCCTTTGCATTAATTACTTTATTACTTTCTCATTTTTATAATGCTATACCGACTGACTTAGTAGGTGGTTTTGCCCTTATGTTTGTGATGGGGGCCATTTTTGGTGAAATCGGCAAACGTTTACCGATCTTCAATAAATATATTGGCGGCGCACCGGTTATGATATTTCTGGTTGCAGCTTATTTTGTCTATGCTGGCATATTTACGCAGAAAGAAATTGATGCGATCAGCAACGTAATGGATAAA---AGCAACTTCCTTAACCTGTTTATCGCAGTGTTGATCACAGGCGCGATCCTGTCGGTAAACCGTAAGCTGCTATTAAAATCACTGCTGGGCTATATCCCAACCATCCTCGCCGGGATTGTCGGCGCGTCCCTTTTCGGTATCGTCATTGGTCTGTGCTTCGGTATCCCGGTCGACCGTATCATGATGCTGTACGTTCTGCCGATTATGGGCGGTGGTAACGGCGCGGGCGCCGTGCCTCTGTCTGAAATTTATCACTCGGTTACCGGACGTTCTCGC---GAAGAGTATTACTCAACGGCTATTGCTATTCTGACCATTGCGAATATCTTCGCCATTATTTTCGCCGCCCTCCTCGATATGATAGGCAAAAAATACACCTGGCTTAGCGGTGAAGGCGAGTTGGTTCGTAAGGCTTCCTTCAAAACC---------GAAGATGATGAAAAGGCCGGTCAGATTACCCATCGTGAAACGGCGGTTGGCATGGTGCTATCCACCACCTGCTTCCTGCTGGCCTATGTTGTTGCCAAGAAAATTCTGCCAAGCATCGGCGGCGTCTCTATTCACTACTTCGCCTGGATGGTCCTGATTGTTGCTGCGCTGAACGCATCAGGTCTTTGCTCACCGGAGATTAAAGCCGGGGCGAAACGTCTTTCTGACTTCTTCTCCAAACAGCTACTGTGGGTGCTGATGGTAGGTGTGGGTGTTTGCTACACCGATCTGCAAGAGATCATCGATGCCCTGACGTTCGCGAACGTAGTTATCGCCGCAATCATTGTGGTCGGCGCAGTCGTTGGCGCAGCTATCGGGGGCTGGTTGATTGGCTTCTACCCGATTGAATCATCCATTACTGCGGGTCTTTGTATGGCCAACCGCGGCGGCTCCGGCGATCTGGAAGTGCTCTCCGCCTGTAACCGTATGAACCTCATTTCATATGCACAAATTTCCTCTCGTCTGGGCGGCGGTATTGTGCTGGTTATCGCTAGCATCGTG
CITN_KLEPN/22-441 AAAATCTTCGGCATGCCGCTCCCCCTTTACGCATTTGCGTTAATTACACTATTACTTTCACATTTTTATAACGCTTTACCCACCGATATCGTCGGCGGCTTTGCCATCATGTTTATTATCGGCGCTATATTCGGGGAAATTGGCAAGCGCCTGCCAATATTCAACAAATATATCGGTGGCGCTCCGGTGATGATTTTCCTGGTGGCGGCTTATTTCGTCTACGCCGGTATTTTTACGCAGAAAGAAATCGATGCTATCAGCAACGTTATGGATAAG---AGTAACTTCCTTAACTTATTCATCGCGGTATTAATTACCGGAGCAATTCTGTCGGTAAACCGCCGCCTGCTGCTGAAATCACTGCTCGGCTATATTCCAACTATCCTGATGGGCATTGTCGGCGCGTCTATTTTTGGCATCGCTATCGGCCTGGTGTTCGGTATTCCAGTGGATCGCATCATGATGCTGTACGTCCTGCCGATCATGGGCGGCGGCAACGGCGCGGGCGCGGTCCCCCTGTCGGAGATTTACCACTCCGTCACCGGTCGTTCTCGC---GAAGAGTATTACTCAACCGCTATCGCTATTCTGACCATCGCTAACATCTTCGCCATCGTCTTTGCCGCCGTCCTCGATATCATCGGCAAAAAACACACCTGGCTGAGCGGCGAAGGGGAACTGGTGCGTAAAGCCTCGTTCAAAGTG---------GAAGAAGATGAGAAAACGGGACAAATCACCCATCGCGAAACCGCCGTCGGTCTGGTGCTGTCCACTACCTGCTTCCTGCTGGCCTACGTCGTGGCGAAGAAAATTCTGCCCAGCATTGGCGGTGTGGCTATTCACTATTTCGCGTGGATGGTGCTGATCGTCGCCGCGCTGAACGCCTCCGGGCTGTGCTCACCGGAAATCAAAGCCGGTGCTAAACGCTTGTCTGATTTCTTCTCCAAACAGCTGCTGTGGGTGCTGATGGTCGGGGTCGGCGTCTGCTACACCGACCTACAGGAAATTATCAACGCCATCACCTTCGCTAACGTTGTTATCGCCGCCATTATCGTTATCGGTGCGGTGCTCGGCGCGGCGATCGGTGGCTGGCTGATGGGCTTCTTCCCAATAGAATCGGCCATCACTGCAGGCCTGTGTATGGCCAACCGCGGCGGCTCCGGCGACCTGGAAGTTCTCTCTGCCTGTAACCGTATGAACCTTATCTCTTATGCGCAAATCTCCTCCCGTTTGGGCGGCGGTATTGTGCTGGTCATCGCCAGCATCGTG