EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03379 alignment
(13 sequences with 666 bp)


Q9RXA8_DEIRA/4-221 GCACTCAGCGTCTTTCTCAAGGACTTGCGACTGGAAGGCCGCAGCAAGGATGTGCTGTCCACCACGCTGTTTTTCGCCGGACTGGTGGTGCTCATCATGGGCTTCGCCTTCGGCCCCGACACCGCCAAGATGCGCGACGCCGCCGCCGGGGTGCTGTGGTGCGCTCTGGCTTTTGCCAGTGTGCTGGCCGCCAACCGCGCCTGGGCGGGCGAGCAGGAAAGCGGGGCGCTCGAAAGC------CTGCTGCTCTACCCGGTGGCCCACGAGTGGCTCTACCTCGGCAAAGCGGCGGCCAACGCCCTGCTGATGCTCATTCTGGGCGTGGTGACCGCCGCGCTGACCGCCATTTTCTTCGACGTGCACTTCGCCAGCCTGGGGCTGCTCGCGCTGACCCTCGCGCTCGGCGTGCTCGGCCTGAGCCTCGTGACCACCTTCTACTCGGCCATCACCGTCAACCTGCGGGCCAAAGAA------GCCTTGCTACCGGTCCTGAGCTTCCCCATCATCATTCCGGTGATGATTGGGGCGGTCAAAAGTACAGTTCTGCTCAGCGGCGGCTTCAATCCGGACGACTACTGGGCGTGGACGCGGCTGCTGCTCGGTTTCGATGTGGTCACGCTGCTGGTGGCGACCTTCGCTTTTCCGCACGCGGTGGAAAGC
CCMB_HAEIN/3-217 TTTTTAGAGATAATTAAACGAGAACTTCAAATTGCGATGCGTAAAAATGCGGAAATTTTAAATCCGCTATGGTTCTTTTTGCTTGTGATTACTTTGTTTCCGCTTGTTATTGGGCCAGATCCTAAATTACTTTCCCGTATCGCACCGGGTATCGCATGGGTAGCTGCATTACTTTCAGCATTGCTTTCTTTTGAACGTTTATTCCGTGATGATTTTATTGATGGCTCTCTTGAACAA------TTAATGTTAACCGCACAGCCTTTGCCAATGACAGCTTTGGCTAAAGTGGTTGCACATTGGTTGCTCACTGGTTTGCCGCTTATTTTGCTATCACCTATTGCGGCTTTGTTGCTTTCTCTTGAAGTGAATATTTGGTGGGCATTAGTTTTGACATTGTTACTGGGCACCCCTGTATTGAGCTGTATCGGTGCTATTGGCGTGGCTTTAACGGTGGGATTGCGAAAAGGTGGC------GTGTTGTTGAGTTTGCTTGTTGTTCCGTTGTTTATTCCTGTTTTAATTTTTGCTTCATCGGTATTGGAGGCAGCAGGATTAAAT---------GTGCCTTATGGGGGGCAACTGGCGATTTTAGGTGCCATGATGGTTGGCGCTGTAACGCTTTCGCCTTTTGCCATCGCGGCAGCGTTGCGAATT
O52687_SHEPU/11-225 TTTTTTACATTACTGCAGCGGGATCTAAAAATCGCGATTCGCCACCGCGGTGATATTTTTAACCCATTGTTATTCTTTATTATGGTTGTCACCCTATTTCCACTTGGTATTGGTCCAGAACCGCAAATGTTGGCGCGTATCGCCCCAGGGATTATTTGGGTTGCGGCATTGCTCGCGTCGATGCTATCGCTTGAGCGCCTTTTTAAAGCCGATTTTAGTGATGGCAGCTTAGAGCAG------ATGCTGCTTAGTCCACAACCGCTCGCCATTTTAGTATTGGCAAAAGTATTAGCTCACTGGTTACTCACGGGTGTCCCACTCATCCTTATCGCACCACTGCTAGCTGTGTTACTGAACTTAGAAGCCAACAGCTATGGAGCCTTGATTGCCACACTGGCTTTAGGCACTCCAGTGTTGTCACTCTTAGGTGCGATTGGCGTAGCATTAACCGTTGGTCTGCGCAAAGGCGGC------GTACTGTTGAGTCTACTCATCCTACCACTTTATATTCCTGTGCTAATTTTCGCGACCAGTGCCATTGATGCAGCAGGAATGAAT---------TTACCCTATGACGGTCAGCTCGCTATAATTGGCGCAATGCTGATCGGTTCGTTAACCTTGGCACCTTTTGCAATAGGTGCATCTCTGCGAGTG
Q9Z650_PANCI/2-216 CTGGTAAGTATTATTCGCCGTGAACTTAAAATTGCCTTTCGCAGTGGTTCGGAAATTATTAATCCGCTGTGGTTTTTCCTGATAGTGATTACGTTGTTTCCGCTGGGAATTGGCCCCGAATCAAAATTACTTGCCAGAATTGCACCGGGTATCGTCTGGGTGGCGGCATTGCTGTCATCATTACTGGCACTGGAACGCTTGTTCCGTGATGACTTTCTGGATGGTTCACTGGAACAC------GTTGGTGTTATTACCGACCCCGTTACCTTTAACGGTACTGGAAAAGTCATAGCCCACTGGCTGGTGACCGGGGTACCGTTAATTATTTTGTCGCCCCTGGCCTCGTTATTATTGTCGCTGAATTTTCAGGGCTGGTACGGGCTGGCGATGACACTGCTACTGGGTACACCGGTGTTGAGTTTTATCGGTGCTATCGGGGTAGGGCTGACGGTGGGGCTCAGACGTGGCGGA------GTATTATTGAGTTTACTGGTTTTGCCTCTGGTCATTCCGGTGCTGATTTTTTCAAGTGCAGCCATTGATGCTGCCAGTCAGGGA---------TTATCGATAAGTGGTTACCTGGCCATATTAGGCGCAATGCTAATCGCCAGTATTACTCTGGCACCTTTTGCCACAGCCGCAGCGGTACGTATT
CCMB_ECOLI/3-217 TTCTGGCGCATTTTCCGTCTTGAGCTGCGTGTAGCGTTTCGCCATAGCGCCGAAATCGCCAACCCGCTGTGGTTCTTCCTGATTGTAATTACCCTTTTTCCGCTCAGTATCGGTCCGGAGCCGCAACTGCTGGCGCGTATTGCACCGGGCATTATCTGGGTTGCTGCGCTGCTTTCATCCTTGCTGGCGCTGGAACGACTGTTCCGTGACGATTTGCAGGACGGCAGTCTTGAACAA------TTGATGTTGTTGCCGTTACCCTTGCCCGCCGTTGTGCTGGCGAAGGTGATGGCGCACTGGATGGTAACCGGTCTGCCGTTACTCATCCTTTCGCCACTGGTAGCAATGCTACTGGGAATGGATGTTTATGGCTGGCAAGTGATGGCGCTGACGCTGCTGCTGGGAACGCCTACGCTTGGCTTTCTCGGTGCACCGGGCGTGGCGCTGACAGTGGGACTTAAGCGCGGTGGT------GTGCTGCTCAGCATACTGGTGTTACCGCTGACTATCCCATTACTCATCTTTGCCACCGCCGCGATGGACGCGGCTTCTATGCAT---------TTGCCCGTTGACGGGTATCTGGCAATTTTAGGCGCGTTGCTGGCAGGCACCGCGACATTAAGTCCTTTTGCGACGGCGGCAGCGTTACGAATC
Q9Z3Z2_PSEPU/4-218 TTCATCCTGTTGTTGCGTCGCGAAGCGCGCCTGCTGTTCCGTCGCCCTGCCGAGCTGGCCAACCCGCTGGTGTTCTTCGCCATCGTCGTGGCCATGTTCCCGCTGGCGGTCGGCCCGGAAAGCCAATTGTTGCAAACCTTGTCGCCAGGCCTGGTCTGGGTAGCGGCGCTGCTGGCAGTGCTGCTGTCGCTGGACGGCTTGTTCCGCAGCGATTTCGAGGATGGCTCGCTGGAACAG------TGGGTGCTGTCGCCGCACCCGCTGGCGCTGCTGGTGCTGGCCAAGGTGCTGGCGCACTGGATCTTTTCCGGGCTGCCGCTGGTATTGTTGCCGCCGCTACTGGCGCTGATGCTGGGGCTGCCGAGCCATTGCCTGCCGGTGCTGCTCGGCTCCCTGCTGCTGGGCACACCGGTCCTGAGCCTGCTGGGCGCGGTAGGTGCGGCGCTGACAGTCGGTCTGAAGCGCGGTGGT------TTGTTACTGGCGTTGCTGATTCTGCCGTTGTATATCCCTGTATTGATCCTGGGCAGTGGTGCGTTGCAAGCGGCGTTGCAAAAT---------ATGCCCGCAGCCGGCCACCTGCTCTGGCTCGCCACGCTGACGGCCCTGGCCGTTACCCTGGCACCCTTTGCGATAGCGGCCGGCCTGAAGATC
O33571_RHOSH/1-215 ATGATCGCGCTTCTCCTCCGGGACCTGCGGCTCGCGCTGCGGGCGGGCGGCGGCTTCGGCCTGGGCCTCGCCTTCTTCCTGCTGGTGGCCGTCCTCGTGCCGCTCGGCGTCGGGCCCGAGCCTGCGACGCTGGCGAAGATCGCGCCCGGCATCCTCTGGGTCGGCGCGCTCCTGGCCTGTCTTCTCTCGCTCGACCGGATCTTCGCGCTCGATCACGAGGACGGATCGCTCGATCTC------CTCGCCACCGCCCCCATCCCGCTCGAGGGGGTGGTGGCGGTGAAGGCCTGCGCGCACTGGATCGTCACCGGCCTGCCGCTGACGCTGGTCTCGCCGCTGCTCGGGCTCCTGATGAACCTGCCGGCCGAGGGCTATCCGCTGCTTCTGGCCTCGCTCGCCATCGGCACGCCGGCGCTCTCGGTGATCGGCACCTTCGGCGCGGCCCTCACCGTCGGGCTGAAGCGGGGCGGG------CTCCTGCTCAGCCTCCTCGTGCTGCCGCTCTATGTGCCGACCCTCGTCTTCGGGGCCGAGGCGGTGCGGCGCGGTGCGCTCGGC---------ATGGATGTCGCGACCCCATTCCTCCTTCTCGGAGGCATCACGGCGGGTGTCGCGGCCCTGCTACCTTTCGCCTCAGCAGCCGCCGTTCGGATA
CCMB_RHOCA/1-215 ATGAGGGCGCTTTTGTCGCGGGATCTGCGGCTGGCGATCCGGGCCGGGGGCGGCTTCGGGCTCGGGCTTGCATTTTTTCTGATCGTGGTGACGCTGGTGCCCTTTGGCGTCGGCCCGCAGGGCGAGATCCTGGCCCGGATCGCCAGCGGCATCCTGTGGCTGGGCGCCTTGCTCGCCTGTCTTCTGTCGCTCGACCGGATTTTTGCGCTCGATTTCGAGGATGGCTCGCTTGATCTT------CTGGCCACCGCGCCGATCCCGATGGAGGCGGTGGTGACGATCAAGGCGCTGGCGCATTGGATCACCACCGGGTTGCCGCTGGTTCTGGCGGCGCCGCTATTCGCCGTGCTGCTGCATTTGCCCGCGCCCGCCTATCTCTGGCTCGAGGTCTCGCTGCTTCTGGGCACGCCGGCGCTGTCGGTGCTGGGCACCTTTGGCGCGGCGCTGACGGTGGGGCTGAAGCGGGGGGGC------TTGCTGTTGTCGCTGCTGGTGCTGCCGCTTTATGTGCCGACGCTGATCTTTGGCGCCGAACTGGTGCGGCGCGGCGCCGAGGGC---------CTGGCGATCGAAGTGCCGCTGGCGATGCTGGCGGGGATCACCGCGGCCACGGTGGCTTTGGTGCCCTTTGCTTCGGCGGCGGCGATCCGGGTC
CCMB_PARDE/1-214 ATGAAGGCGCTGCTGATCCGCGACCTGCGGCTGGCCACGCGCGCGGGCGGGGGCTTCGGCCTTGCGCTGGCGTTTTTCCTGATCGTCTGCACGCTGGTTCCCTTTGGCGTCGGGCCCGAGGCGGGCACCGTCTCGCGCATCGCG---GGCATCCTGTGGGTGGGGGCGCTGCTATCGTGTCTCTTGTCCCTCGACCGCATATTCGCGCTGGATTTCGAGGATGGCAGCCTGGACCTG------CTGGCCACGGCGCCCCTGCCGCTGGAGGGCGCGGTGGCGATCAAGGCGCTGGCCGATTGGCTGGTGACCGGCCTGCCGCTGGCGCTGTCGGCGCCGGTCTTCGGCCTGCTTCTGCACTTGCCGGGACCGCGCTATCCCTGGCTCGTGGCCTCGCTGCTCTTGGGCACGCCCGCGCTGAGCGTGCTGGGCTCCTTTGGCGCCGCGGTGACGGTGGGCCTGCGCCGCGGCGGG------CTGCTCGTGTCGCTGCTGGTGCTGCCGCTTTACGTGCCGACGCTGATCTTCGGGGCCGAGGCGGTGCGACGGGGTGCCGCAGGG---------GCCGATCCGATGACGGCTTTGGTCTTCCTGGCGGCGATCACGCTGGCCACATTGGCGCTGGCCTTCGCCGCAGCCGCAGCCTCCGTCAATCTG
CCMB_BRAJA/4-219 CTGTCCGCCCTCATCCGCCGGGATATCAGGATCGCGCTCCGCGTTGGCGGCGGGGCGCTGATCGGCGTGCTGTTCTTCCTGACCGTGGTGGTGCTGATGCCGTTCGCGGTGGGGCCGGACCTCGCGTTGCTGTCGCGGCTGGGGCCGGCCATTCTCTGGCTCGGCGCCCTGCTGGCGAGCCTGCTGACGCTGGACCGGCTGTTCATGGCCGACCATGAGGACGGCTCGCTCGACCTG------ATCACGATGAGCCGGACGCCGCTGGAACTCGCCTGCGCGGCGAAAGCGCTGGCGCATTGGCTGGCGGCGGGCCTGCCGCTGATTGTCGCAACCCCCGTGCTCGGGCTCTTGCTGAATCTCGACATGGTCGCGACCGGCGCGGTGGCCCTGACGCTGCTCGCGGGCACGCCGGCCCTGACCTTTACCGGCATGATCGGCGCCGCGCTGGCGGTGACGCTGCATCGCGGCGGG------CTTTTGATGGCGGTTCTGGTGCTGCCGCTGTCGATCCCGGTGCTGATCTTCGGGGTCGCGGCCTCCCAGGCCGTGATCGTCGGT------CCCATGTCGTTCGGCGCGCCGTTCTCGATCCTGTGCGCGCTGTCGCTGGTCAGCCTCGTGATCGGCCCCTTCGCCGCGGCGGCGAGCCTGCGGCAT
Q52735_RHIET/1-216 ATGACCGCCCTCTTCCTCCGCGATCTCAAACTCTCGATCCGCGCCGGCGGCGGCGCGCTGATCGGGGTGCTGTTCTTCCTGACAGTCGTCGCCGTCATCCCGTTCGGCGTCGGCCCCGATCTCAAGCTGCTCTCGCGCATCGGCCCCGCCATCGTCTGGATCGGCGCGCTGCTTTCCGCCCTTCTCGGCCTCGACCGCTTGTTCCAGGCCGAGCGCGACGACGGATCCCTCGACCTG------ATGCTGATGCAGGAAACGCCGCTCGTCCTCACCGTGCTGGTCAAATGCTTCGCCCATTGGACCGCCACCGGCCTGCCATTGGTCATCGCCTCGCCGCTGCTCGGCCTCTTCATGAACATGGACGAGGCGGCGATCGGCGCGACCATGCTGACGCTTCTTGTCGGCTCGCCGGCCATCACCTTCATCGGCGCCGTCGGGGCCGCCGTTGCCGTGGCGCTCCCCCGCGGCGGC------CTGCTGGTCTCGATCCTGGTCCTGCCGCTGACCATCCCGGTTCTGATCTTCGGCGTCAGCGCCATCTATGCCGCGGTGGAGGAT------CCCGCACCGTTCCTGCCGCCCTTTCTCATCCTTATCGCGCTCACGCTGTTCTTCGCCGTCATTGGCCCGGCTGCCGCCGCCCTTGCGCTGCGAAAC
O21279_RECAM/4-220 TTTTTATTTCAATTCTATTACCAATTTTCATTTATTATTAAAAATAAAAATGATTATATAAATGCAACACTTTTTTATCTTATTATTTTAATTTTTTTTCCTATTAGTTTAAAGTATAATCAAAACATTATTTTTAATACATCTATTTCTATTATTATTATAGCATCTTTTTTAACAACTATTTTTATTTTAAATCGATTTTTTATAGAAGATAAAGAAGAAGGTCATTTATTAGAATATAATTTATTACAAAATAAAACATCTTTACCTAAACTAATCATTATTAAATGTTTTATTAAATGGTTATTAATATCAATAAGTCTTATTTTAGGAACATTTATAGGTATTATATTATTAAATATTCCATTTTATTATTATTTACCAATTATATTAATACTTTTAATAACTACATTACTACTAATTTTAATAGGTTCAATAGGATCTGCACTTTTTATTGGACACAAAGAAAAGAGT------GTACTTATTTGTTTATTTATTATGCCTTTTTATTTACCTATTTTAATTTTTACAACAAATCTTTTACAAACAATTCTTATTGGT---------GAAACTATTAATAATCAATTTTATTTTATTAGTCTTTTCTTTCTTTTTTTATTAATTTTTTCTCCCAATATTTGTGCATATAATTTAAAATTA
CCMB_MARPO/68-273 TTTAAAATCTTTCTGAAACTGTTTTATCAACATATTTTACTCAATTTATCTACACTAATAACGACTTTTTCTTTATTTTTGTTGTATATCGTAGTCACGCCCTTAATGATAGGCTTTTCTAAAGATTTCTTATGTCATTTCCATTTAGGTTTAATTTGGATTTGTTTGTTGTTTTCCTTTCTTCCT------GAACGTTTTTTTCAAAATGATTTTGAAGATGGTACACTCGAATTG------TATTATTTAAGCGGTTATTGTTTGCAAAAAATCCTACTTTCTAAATTGTATGGTCACTGGGTTCTTCAAATAAGTGGTGTTTTCTGTAGTTTTCCTGTGTTACAACTTCTGTACCAATTTGATCAATCCAAAATGAATTGG------TTCACCATTATTATAGGAAGCCAGATATTTACTCTTATGTGTGGTATTCATTCTTGTTTGGCTCTTGGAATCACATCCAATGGTTGGAACAGCTTGCAAAATCTAACAACCTTACCCACTTTATTGCCCTTAATCGTTTTTTGTACCTCTATTGAAACAGAATGGTTTCATGTTATTTTA------------------------------TTAATGGGATATTTACTTTTGTTTTTATTTTTTTATCCTATTTTGGTCTCAATTACTTTACAAACT