EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03378 alignment
(4 sequences with 1353 bp)


CSE1_SCHPO/518-963 GATCAGTTGCTGACTGTTCGTCAT---AATCATGTTCATATCTTTACAAGTTTACTAATTGCTCCACACATATTACCCGCTCTAAATCAACTTTTCCTAATTGTGGAATCTGCATCCACACCACAAAAACTTGCCGAAAATGATTATCTAATGAAAGCAGTAATGCGAATTATTATTATGTCTCAAGAAGCCATTCTTCCAGCTGCTAGCCTTCTTCTTCAGCACCTCACAAAAATTACGGAAGAGGTTAGCAAGAATCCTTCCAATCCAAAATTTAACCACTATCTCTTCGAATCTATTGGTGCACTTATTCGTAGTTTATCTAAATCTGGTCCCCAAACCGTCTCTCAACTGGAAAATGCCCTACTTCCAGTCTTTCAAAATGTGCTTATAGAAGATGTTACTGAGTTTATTCCGTATGTCCTACAACTGCTATCTCAATTAGTTGAAGCT---AGTGGCAATGAACCTCTTCCTGACTTTGTTGTCAATCTCATACAGCCGTGTTTATCTCCAGCTTTATGGGATTCAAAGGGTAATATACCTGCCTTAGTTCGCCTATTACGGGCAATGATATTTCGTGGTCCTCAGATATTTATTTCCAATAAGTTT------GTTGAACCGGTTTTGGGAATTTTCCAAAAATTGATTTCTTCAAAGGTTAATGATCATTTTGGGTTTGATCTCTTGGACCGAGTTTTCACAGTTTTCAATGCTAACATACTTGCGCCTTATATCAACCACATATTCTTTTTGCTGTTAAGCAGATTAAAAAACTCGAGGACTGAGCGTTTCGTTCTGCGATGCACGATTTTCTTCTTTTTTGTTGCTTCTGAGCAAACGGGTACTTGCGGCCCAGATAATTTGATCCAAGGTGTTGATGCAGTCCAGTCTGGAGTATTTGGCCAATTGATGACTTCAATTATTCTTCCTCAAGCACAAAAATTGGCGCTTCCATTAGATAGGAAAATCAGTGCTCTTGGATTACTGCGACTTCTTACTTGTGATCTAGTACTCGCCCCAGACGCAATTTATGAGAATCTTATTATCCCATTATTAACTTGTATCCTCAAATTATTCGAAATGCCTATTGAACAAGCTCAAACAGATGCAGATGAAGAATTGTTTATGGACGAAATCGATGCTGATTCGATGTCATTCCAAGCTTCCTTTTCCAGATTGGCTACTACTGGCGGAAAGAGGGTTGATCCATTCCCTCAA---ATTACTGACCTTAAGCAGTATTGTGCTACGGAAATGAATCTTGCTAACAGAAATATGGGTGGACGTTTATCTCAAATCATTAGCACGCATCTTCCTGGCGACGGTCAAAGCGTGCTTCAATCATAT
CSE1_PAGMA/527-962 GAGAGGCTGTTCACGATGAGAGGCCCCAACAACACCACGCTTATCACTCCTGTAGAGATGGCACCTTTTACTGAACAGCTGCTCAACAACTTGTTCAAGTCGCTTGCTCTTCCTGGTTCT------------GCAGAAAATGAATACATCATGAAAGCCATCATGCGCACGTTCTCCCTGCTGCAGGAGGCCATTGTTCCCTACATTCCCACTCTGATCGGTCAGCTCACTCATAAGCTCCTCTTAGTCAGCAAGAATCCTAGCAAGCCTCACTTCAACCACTACTTGTTCGAGTCCCTGTGCCTGTCGGTCCGCATCACCTGCAAAGCCAACCCCGCCACTGTCAGCAGCTTCGAGGAAGCACTCTTCCCCGTCTTCACCGAGATCCTTCAGAACGATGTCCAGGAGTTTCTTCCGTACGTGTTCCAGGTGATGTCTCTCCTCCTAGAGATCCACTCCAGCTCT------ATACCCTCCTCCTACATGGCTTTATTCCCTCACCTGCTGCAGCCTGCACTATGGGAACGGACAGGAAACATCCCCCCTCTGGTGCGCCTGCTTCAGGCTTACCTGGAGAAGGGAGGTGCCACTATTGCTGCCTCTGCTGCAGATAAAATACCTGGCTTGCTTGGAGTTTTTCAAAAGCTTATTGCCTCTAAAGCCAATGACCACCAAGGTTTTTACCTTCTCAACAGCATCATAGAGCACATGCCCCCAGAATCGATCACTCAGTACAGGAAACAGATCTTCATTTTGCTCTTCCAGAGGCTACAGAGCTCCAAAACCACCAAGTTCATCAAGAGTTTCTTGGTGTTTGTGAACTTGTATAGTGTCAAATACGGAGCTATT------------GCACTGCAGGAGATTTTTGACAGCATCCAGCCAAAAATGTTTGGTATGGTGCTGGAGAAAATAATTATTCCAGAGGTTCAGAAGGTGTCTGGAGCAGTTGAAAAGAAGATCTGCGCTGTTGGCATTACAAAGGTCCTCACT---GAATGTCCTGCGATGATGGACACGGAGTACACTAAACTCTGGACCCCTCTGCTCCAGGCGCTCATTGGTCTATTTGAGTTGCCAGAAGACGACAGCATCCCA---------GATGACGAGCACTTCATCGACATTGAA---GACACACCGGGTTATCAGACGGCGTTCTCACAGCTGGCCTTTGCAGGGAAGAAGGAGCACGACCCGATTGGAGACGCTGTCGGCAATCCAAAGATCCTGCTAGCTCAGTCACTCCACAAGCTTTCTACTGCCTGTCCAGGACGGGTTCCCTCGATGCTGAGCACCAGCCTGAATGCAGAAGCCCTCCAGTTCCTGCAGGGGTAC
CSE1_HUMAN/527-962 GAACGGCTCTTTACTATGCGAGGGCCTAACAATGCCACTCTCTTTACAGCTGCAGAAATCGCACCGTTTGTTGAGATTCTGCTAACAAACCTTTTCAAAGCTCTCACACTTCCTGGCTCT------------TCAGAAAATGAATATATTATGAAAGCTATCATGAGAAGTTTTTCTCTCCTACAAGAAGCCATAATCCCCTACATCCCTACTCTCATCACTCAGCTTACACAGAAGCTATTAGCTGTTAGTAAGAACCCAAGCAAACCTCACTTTAATCACTACATGTTTGAAGCAATATGTTTATCCATAAGAATAACTTGCAAAGCTAACCCTGCTGCTGTTGTAAATTTTGAGGAGGCTTTGTTTTTGGTGTTTACTGAAATCTTACAAAATGATGTGCAAGAATTTATTCCATACGTCTTTCAAGTGATGTCTTTGCTTCTGGAAACACACAAAAATGAC------ATCCCGTCTTCCTATATGGCCTTATTTCCTCATCTCCTTCAGCCAGTGCTTTGGGAAAGAACAGGAAATATTCCTGCTCTAGTGAGGCTTCTTCAAGCATTCTTAGAACGCGGTTCAAACACAATAGCAAGTGCTGCAGCTGACAAAATTCCTGGGTTACTAGGTGTCTTTCAGAAGCTGATTGCATCCAAAGCAAATGACCACCAAGGTTTTTATCTTCTAAACAGTATAATAGAGCACATGCCTCCTGAATCAGTTGACCAATATAGGAAACAAATCTTCATTCTGCTATTCCAGAGACTTCAGAATTCCAAAACAACCAAGTTTATCAAGAGTTTTTTAGTCTTTATTAATTTGTATTGCATAAAATATGGGGCACTA------------GCACTACAAGAAATATTTGATGGTATACAACCAAAAATGTTTGGAATGGTTTTGGAAAAAATTATTATTCCTGAAATTCAGAAGGTATCTGGAAATGTAGAGAAAAAGATCTGTGCGGTTGGCATAACCAAATTACTAACA---GAATGTCCCCCAATGATGGACACTGAGTATACCAAACTGTGGACTCCATTATTACAGTCTTTGATTGGTCTTTTTGAGTTACCCGAAGATGATACCATTCCT---------GATGAGGAACATTTTATTGACATAGAA---GATACACCAGGATATCAGACTGCCTTCTCACAGTTGGCATTTGCTGGGAAAAAAGAGCATGATCCTGTAGGTCAAATGGTGAATAACCCCAAAATTCACCTGGCACAGTCACTTCACAAGTTGTCTACCGCCTGTCCAGGAAGGGTTCCATCAATGGTGAGCACCAGCCTGAATGCAGAAGCGCTCCAGTATCTCCAAGGGTAC
CSE1_DROME/530-966 GAGAAGATCCTTTCTATGCGGGATGCTAGCAACGCGATCGTTTTTGGTCCTCAGATTTTAGCACCTTACACAACTGAACTAATTAGTGGGTTATTTGCGACCCTTTCACTCCCAGGTTCC------------GGTGAAAATGAGTACGTAATGAAAGCCATTATGCGAAGTTTTTCGGTCTTGCAATCGGCCGCCATGCCCTTTATGGGCGTCGCCCTTCCACGGCTTACCGAGATTCTCACCCAAGTGGCCAAGAATCCATCGCGTCCGCAGTTCAACCACTATCTTTTTGAAACGCTGGCTCTGTGTATAAAAATTGTTTGTCACGCCGATTCCTCGGCTGTGAGCTCCTTTGAGGAGGCATTGTTCCCAGTTTTCCAGGGCATCTTACAGCAGGACATTGTCGAATTTATGCCCTACGTCTTCCAGATGCTTTCTGTGCTGTTGGAAATGCGCGAGGGCACTGGTACCATACCGGAACCCTATTGGGCTTTGTTCCCCTGCTTGTTGTCACCAGCTCTGTGGGACAGGACGGGCAATGTCACACCATTAATTCGCCTGATTTCTGCTTTCATCAAGCAGGGATCTGCTCAGATT------CAAGCCTTGGGTAAACTGAGCGGTATCCTCGGAATATTCCAAAAGATGATTGCCTCCAAGGCTAATGACCATGAAGGGTTTTATCTTCTCCAGAATCTGCTTTCCTACTACCCTCCCGCTGAGATTCAAACTAATCTTCGTCAGATCTTTGGCCTGCTCTTCCAGCGATTGTCTCTCTCAAAGACTCCGAAGTATTTAAGCGGCATCATTATCTTCTTTAGCTTTTATGTGATTAAGTTCAGTGGCAGT------------CAGATGGCTCAATTGATAGATGAGATTCAGCCTAACCTATTTGGCATGCTGCTGGACCGCGTGTTTATCACCGAAATGGGCAAGATTCCCAAGGAACAGGATCGCAAAATGGTGGCCGTGGGTGTCACTAAGCTACTTACA---GAAACTCCTGAGATATTGCAGCAACAGTACGCTACTTTCTGGCCACGACTGCTGCATTCTCTAATCGATCTTTTTGAACGACCACCAGAGAAATTGATGGGTCTCGAAATAGGAGAGACAGCTGGAGTTGCCGAAGAT---CCCGATGCGGGCTATCAAGTGGCATTTGCCCAACTGACTCATGCCCAGCCCAACCAGCAGGATCACCTGGCTGAG---ATTAAGGATGCTCGCCAGTTTCTAGCAACTTCGCTCTCTAAGTTTGCCCAGGCTAGGGCAGGAGAATTTTCCACTTTGTTGTCGCCC---CTGGAGCCGGAGTACAAGCAAGTACTCCAGAAATAT