EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03281 alignment
(4 sequences with 1101 bp)


Q9Y106_DROME/7-368 ATGATGGCCGCCCAGACGCGCATGGTCTATCAGATGAATCGATTCTGCACGGAGAGGGTTCAGGCCAGGATGTACAAGACGGCCACCGCCATCCGGGAGATCTGCAAGATCGTCCAGGACATCCTCAAAGAGGTGGAACTGCAGGAGCCGCGATTCATCTCCAGCCTCGTCGAG---TGCAATGGCAGATTCGAGGGCGTTGAAGTGATATCCCCGAATGAATTCGAGATAGTGCTGTATCTGAATCAAATGGGTGTCTTCAATTTCGTGGACGATGGCACCTTGCCGGGATGTGCTGTTCTGAAGCTGAGCGATGGAAGGAAGCGGTCCATGTCCCTGTGGGTGGAGTTCATAACGGCCAGTGGTTATTTGTCCTCCCGGAAGATCCGTGCCCGTTTCCAGACTCTGGTGGCCCAGGCGTGCGATAAAAGTGTCTACCGCGACATGGTCAAAATGGTGGGCGACACCAGCGAGGTGAAGTTGCGCATTCGGGAGCGATTCGTGGTCCAGATTACGCCGGCATTTAAGTGCTCAGGCATCTGGCCAAGATCGGCGGCCCACTGGCCGGTACCACATCTCCCGTGGCCACATCCCAACATCGTGGCGGAGGTCAAGACCGAGGGCTTCGATCTTCTGTCCAAGGAGAGCGTCATCATGCAG------------AACAAGAACAACAATGCCGCCagcATGGAGGGCGATGCCTGGGTGCTCAGCTTCTTCGAGGCCGAAAACCGTCTGCTGCAAGGTGGCTGTCGTCGACGTTGTCTGAGCATGCTGAAGACCCTGAGGGACAGGCATCTGGATTTACCAGGCAATCCCATCAGTGCGTATCACCTGAAGAACCTGCTGCTCTACGAGTGCGAGAAGCATCCGCGGGACTTTGAGTGGGACGAGGGCTGCATCGCTGACCGCATCAATGGGATATTCCTGCAGCTGATATCCTGTCTGCAGTATCGCCGTTGTCCCCACTACTTCCTTCCCGCACTGGACATGTTCAAGGGTAAATCCCCCAGTGCTTTGGAGCAGGCGGCCAAGCAGGTGTGGCGCTTGACCCGCGAGCTCCTCACAAATGCCAACGCCTTTGAGAAGTTG
Q9U3W6_DROME/1-359 ATGATTGCGGCGCAGTCCAAGATGGTCTACCAGATGAACAAGTACTGTGCGGACCGTGTCCAGGTGCGCAAGGCGCAGATCCACAAGCAGATCCAGGAGGTGTGTCGCATCGTCCAGGACGTGCTCAAGGAGGTGGAGGTGCAGGAGCCGCGCTTCATATCCTCGCTGAACGAC---TACAACGGTCGCTTCCAAGGCCTGGAAGTCATATCGCCCACGGAATTCGAGATCATCATCTACCTGAATCAGATGGGCGTGCTCAACTTTGTGGACGATGGCACCTTGCCGGGATGTGCCGTCCTGAAGCTGAGCGATGGAAGGAAGAGATCCATGTCCCTGTGGGTGGAGTTCATCACGGCCAGTGGGTATCTGTCCGCCCGAAAGATCCGCTCCAGGTTTCAGACCCTAGTGGCCCAGGCCTGCGACAAGTGCGCCTACCGTGACATTGTCAAGATGATCGCCGACACCACGGAGGTGAAGCTGCGCATCCGGGAGCGCATCATTGTCCAGATTACGCCCGCCTTCAAGTGCGCCGGCCTTTGGCCGAGATCCGCCTCCCACTGGCCGCTGCCGGGCATCCCATGGCCGCATCCCAACATCGTCGCCGAGGTGAAGACCGAGGGATTCAACATGCTATCCAAGGAGTGCATCGCACTGCAG------------GGCAAGAACTCC------GCC...ATGGAGGGCGACGCCTGGGTGCTCAGCTTCACCGACGCCGAAAACCGGCTGCTGCAAGGAGCGAGTCGACGACGCTGCCTGAGCATTCTGAAGACCCTGCGTGATCGGCACCTGGACCTGCCCGGCAATCCGGTGACGTCGTACCACCTGAAGACCCTGCTGCTCTACGAATGCGAGAAGCATCCGCGCGAGATGGAATGGGAGGAGAACTGCATCGCGGACCGGATCAATGGGATATTCCTGCAGCTGATATCCTGCCTGCAGTGCCGCCGCTGTCCGCACTACTTCCTACCCAATATGGATCTGTTCAAGGGCAAGTCGCCGGGTGCCCTGGAGAATGCCGCCAAGCAGGTTTGGCGGCTCACCCGGATCATGCTGACCAATGTCCGTTGCCTGGAGGAGCTG
O70299_MOUSE/1-359 ATGATCGCGGCCCAGGCCAAGCTGGTCTACCACCTGAATAAGTACTACAACGAGAAATGCCAGGCCAGGAAAGCTGCCATCGCCAAAACCATCCGGGAAGTCTGCAAAGTGGTCTCCGACGTCCTGAAGGAGGTTGAAGTGCAGGAACCGCGTTTCATCAGCTCCCTCAATGAG---ATGGACAACCGCTACGAGGGCCTGGAGGTTATCTCTCCCACCGAGTTCGAGGTGGTACTCTATCTGAACCAGATGGGGGTGTTTAACTTCGTGGACGACGGCTCCCTGCCTGGCTGTGCGGTGCTGAAACTGAGCGATGGGCGCAAGAGGAGCATGTCCCTCTGGGTGGAATTCATCACCGCCTCTGGCTACCTCTCGGCACGCAAAATCCGTTCCAGGTTTCAGACACTGGTGGCTCAGGCGGTGGACAAGTGTAGCTACAGAGATGTAGTAAAGATGGTGGCTGACACGAGCGAAGTGAAACTGAGAATCCGAGATAGGTATGTGGTGCAGATCACCCCGGCCTTTAAATGCACCGGGATTTGGCCGCGGAGTGCTGCCCACTGGCCGCTTCCCCACATCCCCTGGCCAGGACCCAACCGGGTGGCAGAGGTTAAGGCTGAAGGGTTCAATTTGTTGTCCAAGGAGTGCCACTCCCTGGCC------------GGCAAGCAGAGT------TCG...GCTGAGAGCGATGCTTGGGTGCTGCAGTTTGCAGAGGCCGAGAACAGACTGCAGATGGGGGGCTGCAGGAAGAAATGCCTCTCTATCCTGAAAACCCTGCGTGATCGCCACCTGGAGTTGCCAGGCCAGCCCCTGAACAACTACCACATGAAGACTCTGGTGTCCTACGAGTGCGAGAAGCATCCTCGAGAGTCGGACTGGGACGAATCTTGCCTGGGCGATCGGCTGAACGGAATTCTTCTGCAGCTCATCTCATGCCTGCAGTGCCGGCGGTGTCCCCATTACTTCTTACCGAACTTAGATCTGTTTCAAGGCAAACCCCACTCGGCCTTGGAAAACGCTGCTAAACAAACGTGGCGACTGGCAAGAGAGATCCTGACCAACCCAAAAAGTTTGGAAAAACTT
Q20054_CAEEL/1-364 ATGCTAGGACATAACCAGAACGTTGTTTATCAGGTGAATAACTATTTCAACGAAAAAGTTCAACATCGTAAAGTTCGTGTCACAAAAACAGTACAAAGAATCGCCAAAGTGGTACAAGAAATATTGAAAGAAGTTGAAGCACAAGAACCTCGATTCATTAATACATTAAGTGAAACTACAACTGGAAGATTCGATGGAATTGTGGTACATTCTCCATCCGAGTATGAGGCAGTGCTATACCTCAACCAGATGGGTGTCTTCAATTTTGTTGACGACGGAACAATTCAAGGATGTGCAGTTCTCAAACTAAGTGATGGTCGGAAAAGATCAATGTCCCTTTGGGTCGAGTTCATTACTGCTTCTGGATATTTATCAGCTCGCAAGATTCGCCACCGATTCCAAAATATTGTGGCTCAAGTTTTACAAACTCCACAATTCAGTGATTACTGTAAGTTGCTACAAGATAACACTGATGTGAGAGTTCGAGTAGATGACAAGTACACCGTTCAAATTACTTGTGCATTTCGATGCAACGGAATCTGGCCTCGATCAGCGAGTCATTGGCCAATTGCAGGACTTCCATGGCCGAACGCCGCGTTGGCGAATCAGACAAAAGCCGAGGGATTCGACTTGACGAGTCGTGAAACTGCAATCACTCAACAAAATAATCCGAATAAGCAAGCG---AGCAGT...ATGGAAGCCGATGCCTGGGCAATGAAGATGCATGGTGCAGAGAACATGTTACTAACTGGAGGT---CGGCGGAAGACATTGAGCATTCTGAAATGTCTTCGAGATGCTCACATGGACTTTCCGGGAACACCAGTAACAAACTACATACTGAAGACATTGGTATTGTACGAATGTGAGAAGCACTGTAGTGAATACGAATGGGAAGATCCAAATATCGGAGATCGCCTTGTCGGAATTCTTCTACAACTAGTCAGCTGCCTCCAATGTCGTCGCTGTGCTCACTATTTCCTTCCATCTTTGGATCTTTTACGTTCAAAACCAGTCCATTCCATTGAACATTCCGCCCAACTCGCTTGGCATCTCGTTCGCAAACTAATGATCGACCCAAATGCTTTGCAAAGTTTG