EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF03168 alignment
(9 sequences with 468 bp)


O03983_ARATH/2-151 GCGAGCTTGCTAGATAAAGCCAAGGACTTCGTGGCGGATAAACTCACCGCGATCCCT------------------AAACCGGAGGGTTCAGTTACGGACGTTGACCTCAAAGACGTGAACCGTGACTCAGTTGAGTACTTGGCCAAAGTCTCTGTCACCAATCCTTACAGTCATTCGATTCCGATCTGTGAGATCAGTTTCACTTTCCACAGCGCCGGCAGGGAGATTGGAAAGGGGAAGATACCGGACCCGGGTTCTCTGAAAGCTAAGGACATGACGGCTCTTGATATTCCCGTGGTGGTGCCGTATAGTATACTGTTTAACCTGGCTCGAGACGTTGGTGTGGACTGGGACATTGACTACGAGCTCCAAATCGGTCTAACCATCGACCTTCCTGTTGTAGGGGAATTTACTATCCCTATCTCTAGTAAGGGAGAAATCAAACTTCCTACTTTTAAAGATTTCTTC
LE14_SOYBN/2-151 TCGCAGTTGTTGGACAAAGCCAAAAACTATGTTGCGGAGAAAGTCACGAACATGCCC------------------AAGCCCGAGGCGAGTGTCACCGACGTGGATTTCAAGCGCGTGAGCCGCGACAGCGTCGAGTACTTGGCTAAGGTCTCTGTTTCCAACCCTTATTCCACTCCCATTCCCATTTGTGAGATCAAGTACTCCCTCAAAAGTGCTGGCAAGGAGATAGCATCAGGGACAATACCTGACCCAGGGTCACTGAAGGCAAGTGACACAACAATGCTGGATGTGCCAGTGAAGGTGCCTCATAGCATATTACTGAGCTTGGCAAAGGACATTGGTGCAGATTGGGACATTGATTACCAATTGGATCTTGGTCTAGTTATTGACCTTCCTGTCATTGGCAACTTCACCATTCCTCTTTCTCAGAAGGGAGAGATAAAGCTCCCAACCCTCTCTGACATGTTT
LE14_GOSHI/2-151 TCGCAGTTGTTGGAGAAGGCGAAGGACTTCGTGGTGGATAAGGTGGCCAACATAAAG------------------AAGCCGGAGGCTAGTGTCTCGGACGTTGATCTGAAACATGTGAGCCGTGAGTGCGTCGAGTATGGCGCTAAGGTCTCTGTCTCCAACCCCTACAGCCATTCCATCCCCATTTGTGAGATCTCTTACAATTTCAGAAGTGCTGGAAGAGGGATAGCATCAGGGACAATACCAGACCCGGGGTCATTGAAAGCCAGCGACACAACGATGCTGGACGTGCCAGTGAAGGTACCGTATAACATCTTAGTAAGCTTGGTAAAGGATATTGGTGCAGATTGGGACATTGACTATGAATTGGAATTGGGTCTCACCATTGATCTTCCTATCGTGGGGAACTTCACTATCCCTCTCTCTCAGAAAGGAGAGATCAAGCTTCCTACTCTCAGTGACATCTTT
O82355_ARATH/17-166 TCAAGCTTGTTGGACAAAGCCAAAGGTTTCTTTGCGGAGAAGCTGGCGAATATTCCG------------------ACGCCGGAAGCAACCGTGGACGACGTTGATTTCAAAGGCGTGACACGTGATGGAGTAGATTATCACGCCAAGGTCTCCGTCAAGAATCCTTACTCTCAATCCATCCCTATCTGCCAGATCTCTTACATCCTCAAGAGTGCCACAAGGACGATCGCGTCAGGCACGATACCGGACCCGGGTTCGTTGGTTGGGAGCGGCACGACGGTTCTGGACGTACCGGTTAAGGTGGCTTATAGCATAGCGGTTAGTCTGATGAAGGATATGTGTACGGACTGGGACATTGACTATCAACTAGACATTGGGCTAACCTTCGACATTCCTGTTGTTGGTGATATCACCATTCCTGTCTCTACTCAGGGAGAGATCAAGCTCCCTTCCCTTCGCGACTTCTTT
Q40159_LYCES/1-150 ATGGATCTAATTGACAAGGCGAAGAATTTTGTGTCGGAGAAGATAGCCAACATGGAG------------------AAACCGGAGGCAACCATCACCGACGTCGATCTTAAGGGGATCGGTTTCGACGGCCTTGCTTTTCACGCTAAAGTCTCCGTTAAGAACCCTTACTCTGTTCCTATTCCAATCATGGAGATCGATTACGTCCTCAAAAGCGCCACCAGGGTAATCGCATCAGGAAGAATTCCAGACCCAGGGAGCATAAAGGCAAATGACTCAACCATGTTAGATGTGCCAGTGAAGGTTCCTCACAGTGTGCTAGTGAGTTTGGTTAGGGACATTGGAGGAGATTGGGACGTCGATTATACCCTGGAATTGGGTCTCATTATTGATATTCCGGTCATTGGCAACATCACCATTCCCCTCTCTTATAGCGGCGAGTATAAGCTTCCTACATTGTCAGATTTATGG
Q9SPJ4_CAPAN/2-151 GCAGATTTGATGGAGAAAGCGAAGAATTACGTGGTGGAGAAGGTGGGGAATATGGAG------------------AAACCAGAGGCAGAAATAACAGACGTTGATATGAAGAAAGTGAGCATGGACAGTATTTCTTATCATGCTAACGTCGCTGTCAAGAACCCTTACTCTGTTCCAGTACCCATCATGCAAATCTCTTACGCCCTCAAATGCTCTGGCAGGATAATAGTATCAGGAACAATTCCAGACCCGGGGAATATAAAGGCAAATGACACAACCATGTTAGATGTGCCAGTGAAAGTTCCTCACAGTGTGCTGGTGAGCTTGGCTAAGGATATTGGTAAAGATTGGGACATTGACTATACACTTGAATTGGGTCTCACCATTGACCTTCCTGTCATTGGAAATTTCACCATTCCACTCTCTCATAGTGGTGAGATCAAGCTTCCATCAATCTCTGACTTATGG
DRPD_CRAPL/2-151 GCTCAGCTGATGAACAAGGCCAAGAACTTCGTCGCAGAGAAGGTCGCCAACGTCGAA------------------AAGCCCAAGGCATCGGTGGAGGACGTCGACCTAAAGGACGTCGGCCGCCATGGAATCACATACTTAACCAGAATCTGCGTCGAAAACCCTTACAGCGCCTCCATCCCCGTCGGAGAAATCAAGTACACCCTCAAAAGCGCCGGCAGGGTTATTGTTTCTGGCAACATACCTGACCCAGGCTCGTTGAAGGGAAACGATAAGACTATGCTCGAGCCAGCCATTAAAGTGCCACACAGTGCTTTAGTGAGCTTGATAAAGGACATCGGCGCCGACATGGATATCGACTACGTGCTCGAGCTTGGGCTCGTCGTCGATTTGCCGGTGATCGGAAATTTCACGATTCCATTGTCTCACAAGGGGGAGATGAAGCTTCCCGGTTTGTCCGACATTTTC
Q9ZQW6_PSEMZ/2-151 GCGAGTCTGATGGACAAAGCGAAACAGTTCGTAGTAGACAAAATCGCCCATATAGAA------------------AAACCGAGCGCAGATGTTACAGATATCGATATGAAAAATCTTACCACGGACTCAGTCACTCTGGAGAGCGCGATTGACATTACCAATCCTTACGATCATGACCTACCAATTTGGGAAATTTCATTTAGACTCCGAAGCGCAGACAAACTGATAGCGTCTGGAACAATTAAAGATCCTGGGTCAGTGAAGGCCAATGACAAGACAGGCATGATCGTTCCAGTGACAGTGCCGTACAACTTCTTGATCAGCATTATGAAAGACCTTGGCAGGGATTGGGATATTGACTATGAGTGGGATATTGGGCTTACCATGCACATTCCTGTTGTTGGGAAATTCACCCTTCCCCTCAACAAGAAGGGCACTATGAAGCTGCCCACTCTGTCAGATATTTTT
O80576_ARATH/40-195 GGTGGATTCCTCGATAAGGTGAAAGATTTCATTCATGACATTGGTGAGAAACTCGAGGGAACCATTGGCTTTGGGAAGCCAACTGCTGATGTCTCTGCGATTCATATCCCTAAGATCAATCTTGAGAGGGCAGATATTGTTGTGGATGTGCTTGTCAAGAACCCGAATCCAGTTCCTATCCCTCTCATCGATGTCAACTACCTGGTCGAGAGCGATGGGAGGAAACTGGTTTCTGGTTTGATCCCGGATGCTGGAACACTCAAGGCTCATGGAGAAGAAACTGTGAAGATACCATTGACGTTGATCTATGATGACATCAAGAGCACTTACAACGATATCAACCCCGGGATGATCATACCTTACAGAATCAAGGTTGATCTGATTGTGGATGTGCCAGTATTGGGAAGACTGACATTGCCGCTGGAGAAATGTGGAGAGATCCCAATTCCAAAGAAACCTGATGTTGAT