EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02982 alignment
(3 sequences with 480 bp)


SCYD_ASPFU/9-168 ACACTCGAGTTCCACGACTATCTTGCCCTAAAAAAAGTCCTCTTTGACTGGGCAGACAGCTATGACGCCAAGGACTGGGATCGACTTCGAAGCATCATCGCCCCGACCCTTACCGTGGACTACAGGCAGATCGGACTGCGAAAGTGGGATGACATGCCTGCGGAAGACTACATGGCCATGATTTCTGACATGGACTTCTTGGGTGACCCCACCGTCAAGACCCAGCATCTGCTGGGCGAGTCCTGGTGGGAAAAGATCTCCGATACCGAGGTCATTGGCCACCATCAGCTGCGCGCCGCCCATCAGGTCTACACGGACAGCACCTTGCAAACTGTCAAGCTCAAGGGGCACGGGCATGCCACCAATGAGCACTACTACCGCAAGGTCGACGGCGTGTGGAAGTTTGCCGGCCTGAAACCTACCGTGCGGTGGAATGAGTATCAATTCGAGGATGTCTTCCGGGCCGCGAAGCCATCAGTC
SCYD_MAGGR/10-169 GAGATAACCTTCTCAGACTACCTGGGCCTCATGACTTGCGTCTATGAGTGGGCAGACAGCTACGACTCCAAGGACTGGGATAGGCTGCGAAAGGTCATTGCGCCTACTCTGCGCATTGACTACCGCTCCTTCCTCGACAAGCTCTGGGAGGCAATGCCGGCCGAGGAGTTCGTCGGCATGGTCTCGAGCAAGCAGGTGCTGGGCGACCCCACCCTCCGCACGCAGCACTTCATCGGCGGCACGCGCTGGGAGAAGGTGTCCGAGGACGAGGTCATCGGCTACCACCAGCTGCGCGTCCCGCACCAGAGGTACAAGGACACCACCATGAAGGAGGTCACCATGAAGGGCCACGCCCACTCGGCAAACCTTCACTGGTACAAGAAGATCGACGGCGTCTGGAAGTTCGCCGGCCTCAAGCCCGATATCCGCTGGGGCGAGTTCGACTTTGACAGGATCTTTGAGGACGGACGGGAGACCTTT
SCYD_GLOLA/7-166 AACATCACCTTTGAGGACTACCTCGGTCTCAACGCCGCTCTCTTCGAGTGGGCCGACTCCTACGACTCCAAGGACTGGGACCGTCTCCGCAAGTGCATCGCCCCCGAGCTCCGCATCGACTACCGCTCCTTCCTCGACAAGATCTGGGAGGCCATGCCCGCCGAGGAGTTCATCGCCATGATCTCGGACAAGTCCGTCCTCGGCAACCCGCTCCTCAAGACGCAGCACTTCATCGGCGGCTCCCGCTGGGAAAAGGTCTCGGACACGGAGGTCATCGGCCACCACCAGCTGCGCGTGCCGCACCAAAAGTACACCGACGCCTCGCGCACCGAGGTCGCCGTCAAGGGCCACGCCCACAGCTACAACATGCACTGGTACCGCAAGGTCAACGGCGTGTGGAAGTTCGCCGGTCTGAACCCCGAGATCCGGTGGTCCGAGTACGACTTTGACGCCGTCTTCGCCGACGGCCGCGACTCGTAC