EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02751 alignment
(4 sequences with 192 bp)


T2AG_SCHPO/51-100 AAGGTCCGCTCTCGTTTAACATTCAAGGGTCATTTGGATACATATCGGTTTTGCGACGAGGTTTGGACGTTTATCATAAAAAATCCTAGCTTTCGATTTGATAAC------------------------------------------GAAACTGTTACTAGCAACAAAATTCGTATAGTCGCATGTGCAACT
TOA2_YEAST/55-118 AATACCCAATCTAAATTGACTGTGAAAGGAAACCTGGACACATATGGATTTTGCGATGATGTTTGGACTTTTATCGTAAAAAATTGTCAGGTTACTGTTGAGGACAGCCACCGCGACGCCTCCCAGAACGGGTCTGGAGATAGCCAAAGTGTAATTTCGGTGGATAAGTTGAGGATTGTGGCATGTAACTCA
T2AG_RAT/51-100 AGAGTCAGGAACAGAGTCAATTTCAGGGGCTCTCTAAATACATACAGATTCTGCGATAATGTTTGGACTTTTGTATTGAATGATGTTGAATTCAGA------GAGGTGACAGAACTT------------------------------------ATTAAAGTGGATAAAGTGAAAATTGTAGCCTGTGATGGT
T2AG_ARATH/52-101 CAAGTGAAGACCAAGGTGTCCATCAAGGGACACCTGCACACTTACAGGTTCTGTGACAATGTCTGGACCTTCATATTACAGGACGCAATGTTCAAGAGTGACGATCGTCAAGAGAAT------------------------------------------GTGAGCCGGGTGAAGATAGTGGCATGTGATTCC