EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02674 alignment
(20 sequences with 528 bp)


Q9ZEB2_RICPR/4-158 TTTTTTGATATTACTATTTTTGCTATTATTACTCTCTTCTCATTTTTTGGCTTATATCAAGGTATAGTCGGTTTTTTAACTAGAATACTAGGTTTTATTGCTTCTATAATGTTAGGATATTTCTTATATCCATATATTTCTGCACAAATCGTGAAATATATTGAGAATGAGGTTATAAGCATCATT---------------------------------------------------------------ATTACCAGTGTTATATCTTATGTTATTTCTTTAATTTTATGTGTTTTTATAGTTTATAAATTTCTTGCTATAATTTCGTTTATGCGAAACGGTTTTATTGATAGATTCCTAGGGCTATTAGTAGGATTTGTCTTAGGTAGTACTATATCGTTAGTACTATTTTTGATAACAATGATCTTTACTTCTGAAAATTATTTTCAAAGTAAATCTTTAAAAGACTTTGTAATAAGTAGCAAGCAGAACAAATATGGAGGAGTACTGAAATTTTCTGTTACTACT
Q9CB95_MYCLE/9-161 TGGCTGGATATCGCTGTTCTAGCGGTCGCGTTCATCGCTGCCATTTCGGGCTGGCGTTCGGGCGCGTTGGGGTCTCTGCTGTCGTTAATCGGCGTACTGTTCGGCGCAATGGCGGGCGTGCTGCTGGTGCCGCACGTCGTTAGCCACATCAGTGCTCCGCGCGCCAAATTATTCGCCGCCCTTTTT------------------------------------------------------------------CTGATCCTCGCATTGGTTGTGATTGGTGAAGTCGTCGGTGTGGTGCTGGGACGTGCGGTGCGCAGCGCGAACCGCAGCCGGACAGTGCGATTGGTTGACTCGGTCATTGGGGTTGGGGTTCAGCTCATTGTAGTGCTGACCGCGGCTTGGCTGTTGGCGACACCGCTGACCCAGTCGAAAGAGCAGCCAGAGCTGGCCTCC---GCGGTCCGGGGTTCGCGGGCGCTCGCTTCAGTCAATGAGGTCGCGCCACCCTGGCTGAAGACGGTGCCTAAG
O51707_BORBU/8-161 AAAATAACTGGAATAGTAGACATATTAATAATAATAATTTTTACATCTTTGGGATTTAGAGGATTTTTAAGAGGATTTATTAAAGAAATTAGCGGATTTGCTGAAGTTTTTGTTTTAATCCTACTGCTTTACAAAAAAACTGAAGAATTTAGAAGGTTTGTTGAACCTATTATTGAGCTATCCTAC------------------------------------------------------------ATTCAAGCACTACTTGTATTTTTTTTGCTTATACATATAGGATTTTTAATACTACAATCCCTAATAGAATCAATAATAAGTCAACTTAAATTGCTATTCTTCAATAGAATACTAGGCTTAGTGCTTGGCCTACTTGAAGCTTTTGGAATAATTGCAATCGTGGTTTACATAATACACTCACAACAAATATTTAAACCTGAATATTTC------CTAAAAGAAAGCAAACTACTTGATTATTTAAATCCTGGAATAAACTATCTCTTTAAAATTTCAAAAACA
Y522_TREPA/5-157 ACCCTGGATCTCATTCTTGGAATCATCATGGGGATAGTGACCGTCCGTGCCACCATGCGCGGGTTTGTCGATGAGTTCTTTTCTAAGGCAAGTATCCTGTGCGCAGCAGTTGTTGCAATACTGTGTCATAAAAGGCTCGTGCCCTTGACACGTGTGTTGTTAGGCCACAGTATTCTGCTTCCGTGT---------------------------------------------------------------ATAACGTTCTTGATTACCTTTATGGGCGTCTATTGCGTTATGCTCTTCCTCCGTTCACGTATGCGCACGTATGCTACGCGCGATCTTATCAGTGGTTTTAATCAGGTGTTTGGCTTTTTTTTCGGGATAATTGAAGGGAGTGTACTACTCACTGTTATCCTTTTGCTTTTACACGTGCAGCCTTTTGTATCTGTTTCGCATATG------TTGCATGAAAGCGTAATTAACACTGTTCTCTCTCCCCTTGTCTTAGATGGCGTTCGCTATATGCGCCTG
Q9A7R1_CAUCR/3-155 CCGTTCGACATCATCGCCGGCCTGCTGCTGCTGATCTCAGGCGTCACGGGCTGGGTGCGCGGCGCATCGCGCGAGCTGACCTCGGCGCTGTCCTTCATCTTCGCCGCCGCCATCGCCCTGTTTGGCCTGCGCGTCACCGGCCCGCTCTTCCGCGAGATGATGGACCCCGACTGGGCGGCGACCGCC---------------------------------------------------------------ACGGCGATCCTGGTCGTCTTCGTTATCGTTTTCCTGATCGTGCGTCTGATCGGCGGGCGGATCACCGCCAGCCTGCACGACACCTCAGCCGGCGTTCTCGACCAGGCGGTCGGCGCCGGCTTCGGCCTGATCCGCGCCCTGGTGATCCTGGGCGTGTTCAATCTTCTTCTGCATCTGGCGACGCCCCCGGACCGCATGCCGCGC------TGGGTCGAGGACTCTATTTTCTATCCGCTGTCGGAAGTCAGCGGCACCGTGCTGAAAGTCTTCGCCCCC
Q984U9_RHILO/5-157 CTGCTTGACGGAATCCTGGTCGGCTTCACCCTGGTCTCGGCGATGCTCGCCATGGTTCGCGGCTTTTCGCGCGAGGTCCTGTCGGTCGTCTCGTGGGCGGCGGCGGCGGCGGCGGCTTTCTTCTTCTACAAGCCGGTCCTGCCCTATCTGAAGCCTTACATCGAGAATGAAAAGATTGCCATGGCG---------------------------------------------------------------GCCTCCGCCGGCGTCGTCTTCATCATCGCGCTGATCGTCGTCTCGGTCATCACCATGAAGCTCGCCGACTGGATCATCGATTCGCGCATCGGCGCGCTCGACCGCACGCTCGGTTTCCTCTACGGCGCCGCGCGCGGCATCCTGGTCGTCGCGGTGGCGCTTTTGTTCTTCAACTGGCTGGCCGGCGCCAAGGCCCCGGCCTGG------GTGACGGACGCCAAATCACGGCCATTGCTGGAATCGATCGGCGCCAAGATCGAGAACCTGCTGCCCGCC
Q9PC37_XYLFA/1-152 ATGATCGATCTGATCCTAGCCATCATCATCTTGGTTTCGGCATTATTGGGCCTATTACGTGGCTTTGTAAGCATTATAATAAGTACATCCTCCTGGCTACTGGCCAGCTGGGCGACATTTGAGTTTGGCAATACAGCGAGTCATTGGCTAGCAAGCCATGGCGTTCCATCGACTACTGAAATATTG---------------------------------------------------------------TGTGGTTATGCGTTGGTGTTCATCGGGACTTTGATGACAGTTGGCGCAGTGGGTATGCTGATGCACGCTGGGATCAACGCAATACGTTTAAACAACATAGACCGCATATTCGGCTTTGCCTTAGGGACATTTCGTGGCGGCTTCATTGCTTGCGTACTGTTACTGATGATTGGC---TACACTCCATTGGCGCATGAACCTGTT------TGGCGCAACTCACGATTGGTACCATTACTGCAACCTGGAGTCTCATGGATGCGTGCTAAGTTGCCGCAG
Q9K0C3_NEIMB/6-157 ATTGCCGACCTCCTCGTCTCCGCCGTCATCGCCGCCTGCATCGTGCTATCCGCGATGCGCGGCGTGATTGCGGAGGCAGGCTCAATGGCGGCATGGGTGGTTTCCTTCTTTTTCGCCAAACTCTTTGCCGCCTCCTTCGCCGACCTCGCCTTTGCCTCGTTCCAACCCCGCCTGTTTGCATTGGCT---------------------------------------------------------------CTGTCGTTCATTTCCCTGTTCGTCATTGCCTGTCTGATCCAGAAAATGCTCCGTTCGCTGCTGACCAGCGCAGTTTCGGCGGTCGGTTTGGGCTTTGCCAACCGCATTTTGGGCGGCGTATTCGGTGCATTGAAAGGCGTTTTGATTGTTACCCTGCTGGTCATGCTTGCTTCA---AAAACCGACCTGCCCGATACCGAAGAA------TGGCGGCAATCTTACACACTGCCGTTTTTCGTATCGCTTTCCGAAGCCGTGTTGAACCATAGCGGCGGC
Q9FAY5_PSEAE/1-147 ---------------ATGGTCGCCATCATCGTCGTTTCCAGCCTGATCAGTCTGAGTCGCGGCTTCGTCAAGGAAGCCTTGTCCCTGCTTACCTGGATAGTCGCCGGCGCGGTGGCCTGGATGTTCGGCGGGGCGCTGGCGCAGCACCTGGGCGAATACATCCAGACCCCCTCGGCCCGCATCATC---------------------------------------------------------------GCAGCCTGCGCGCTGCTGTTCATCGCGACCCTGCTGCTCGGGGCGCTGGTCAACTACCTCATCGGCGAACTGATCCGGGTCACCGGCCTCTCCGGCACCGACCGCTTCCTCGGCATGGTCTTCGGCGGTGCGCGCGGCGTACTGCTGGTCGTGCTGCTGGTCGGCCTGCTCAGC---CTGGCCCCGGTACAGCAGGACCCTTGG------TGGCAGCAGTCGGTGCTGATGCCGCATTTCCTGATGGTTGCCGACTGGTCGAAGAACTTCATTCTCGGT
Q9CMV3_PASMU/1-152 ATGATTGATTATATTATCATCGCCATCATTGCATTTTCGATTATTATCAGTCTATTACGTGGATTTATTCGAGAAGTGATGTCAGTCGCAAGCTGGGTCGTTGCTTTTTTTGTGGCGAATCACTTTTATCCTTATCTCGCTAATTATTTAACCCAA---ATCGAATCCCTTTACTTGCGCAATGGC---------------------------------------------------------------ACGGCAATTGCGATCTTGTTTGTTGCCACATTAATTGTGGGCGGGATTGTAAATCATATTTTGGGTGAGTTAGTGGATAAGACGGGGTTAACCGGGACTGATCGCGTACTAGGTGCCTGTTTTGGACTTATTCGAGGCGTATTGATTGTGGCAGCATTGTTATTCTTTATGGATACCTTTACGAATTTTAGCCAAACTGTTTGG------TGGAAAGAATCAAAACTCATTCCACATTTCGGCTTTATTGTTGAGTGGTTTTTTCAACAGTTACAAGCA
CVPA_ECOLI/3-154 TGGATTGATTACGCCATAATCGCGGTGATTGCTTTTTCCTCTCTGGTTAGCCTGATCCGCGGCTTTGTTCGTGAAGCGTTATCGCTGGTGACATGGGGTTGTGCTTTCTTTGTTGCCAGTCATTACTACACTTACCTGTCAGTCTGGTTTACGGGC---TTTGAAGACGAACTGGTTCGAAATGGG---------------------------------------------------------------ATTGCCATCGCGGTACTGTTTATCGCTACCCTGATCGTTGGTGCTATCGTGAACTTCGTGATAGGCCAGTTGGTGGAGAAAACGGGGTTGTCAGGCACCGATCGGGTGCTGGGCGTCTGTTTCGGTGCGTTGCGCGGTGTGTTGATTGTTGCTGCCATTCTCTTCTTTCTCGACTCCTTTACCGGGGTGTCGAAAAGCGAAGAC------TGGAGCAAATCACAGCTGATCCCGCAATTCAGTTTTATCATCAGATGTTTTTTTGATTATCTGCAAAGC
Q9KTA0_VIBCH/3-154 TGGTTAGATATTGTCATTTTAAGTGTGATCGGCTTGTCTGCGCTGATCAGTCTTGTTCGCGGCTTTGCCAAAGAAGCCTTGTCTTTAGTGATTTGGTTTGGGGCGTTTTATATCGCTTCGGAGTACTACGCCAAACTGGCGGTGTATTTCACCAAC---ATTAAAGATGACATGTTTCGCAATGGA---------------------------------------------------------------GCGGCGATTGCGGCTCTGTTTGTGGCGACATTGATCGTCGGTGCTATCGTTAACTACGTGATTGCCCAACTGGTCGAAAAAACAGGACTCTCAGGAACCGACAGAATTCTCGGTGTGGTGTTTGGTGCACTACGTGGAGTGTTGATTGTCGCAGCAGGTCTGTTCTTCATGGATGCGTTTACCGCATTTCCAAATACAGAGTGG------TGGAAAAGCTCGCAGCTAGTGCCTGAATTCAGTCGCGTTATTGCTCCGTTCTTTGAACACCTAAAAGCA
Q9PIA4_CAMJE/5-158 TGGTTTGATGCTTTTATTTTAGGATTTACCTTGCTTTTAGGGCTTAAGGGTATTATCAATGGTTTGATAAAAGAAATTTTTGGGCTTTTGGGTATTATTGGTGGTGTTTTTATTGCTTCAAAATATGCAACTCAAGCAGCTGAATTTATACAAAGTACTTTTTATAAGATAGAAAATCAAAGCTTAGCTGGA------------------------------------------------------TTTGCTGGATTTTTGGCCATATTAATTATTTTTTGGATAGCTTGTTTGTTGGCAGGTAATTTTCTTTCTAAGTTGATTAAATTAAGTGGCCTAGGTTTTTTAGATCGTATTGGTGGCTTTATATTTGGCGGGGCAAAAATCTTTTTAATTTTTGCAATTTTAGTTTTTTGTGTAGCAAGAATCGATTTTTTAAATGATAAATTAGATAATTTTGCTAAAAATAGCTATACTTTGAATTTGCTTAAAGAAACTGGATCTTTTATTATGAAT------------
Q9ZMP9_HELPJ/3-160 TATATTGATTTGGCGTTACTTGTGGTAGTGGTAGCCTTTGGGATTAGGGGGTTTTATCATGGCTTCGTGAGTGAAATAGCAGCGACTTTGGGGATTGTGCTTGGCGTTTATTTGGCGTCTCGCTATTCTGTGGCTGTTGGGAATTTATTTTCAGAGCATTTGTATGATTTAAGAAATGAAACCATGACCAAT------------------------------------------------------CTCATTGGTTTTTTACTGGTGTTGGCGTCCATTTGGGTGTTTTTTTTAGCTCTTGGAGTGTTGCTAGGCAAGATGTTAGTCTTTAGCGGTCTAGGCATTATAGACAAGGCGTTAGGGTTTATTTTTTCATGTTTGAAGACTTTTTTAGTGCTTTCTTTCATCCTTTATGCGCTCTCTAAAATGGATTTAATGAAAGACGCTAACGCCTATTTGCAAGAAAAGAGCGCTATTTTCCCCACCATGAAAAGCGTCGCTAGTAAGATCATGCGCCTTGATGGCGTC
Q99UW3_STAAM/2-172 GTCATTGATTTTATCATAATCATTTTCTTTGTGTATTTTGTCATCGTTGGATTCAGACGAGGTTTTTGGTTATCTATGATACATTTGAGTGCAACGATTGTATCATTGTGGATTGCCAGTCAATTTTACAAATCTATTGTAGAAAGATTAATTGTATTTATTCCATATCCTAAAACAACAGCATTTAATACAACTTTTGCGTTTCATTTTAAT---------CATCTACAAAATCGATTTGAAGCGATTGTAGCTTTTTTAATGATTACATTGTTTTGTAAGTTCATTTTATATCTAATTATCGTAACTTTTGATAAAATAATAGCGTATCAAAACATTCATATTTTCAGTCGTGCAATGGGAATGATAGTTGGTGTGTTTATGACGATAATTGTCTTACACTTTACGTTATATCTATTGGCATTATATCCTAACGAAGCATTACAACATCAG------CTTAAAATATCTATTGTGAGTCATTCATTGATTTTTCACATCCCATATTTATCGGCTTTCACCATTAAT
P94543_BACSU/1-170 ATGCTAGATATCATCATCTTAATCTTGCTCCTGATGGGGACTTTACTGGGGTTAAAACGCGGTTTTATCCTGCAGTTTATCCGCTTGACGAGCTTTATTTTATCAATTGCCTTTGCGGCTTTATTCTATAAAAACGTGGCACCGCATTTACAT---TGGATTCCCGCACCCGATTTTTCAGCGGGACAGCCGGCTCTTTCTTTT------TTTACGGGG---AATTTGGAAGCAGCGTACTATAATGCGATTGCGTTTATCGTTTTATTTATCATTGCTAAAATCTTACTGAGAATCATCGGCTCGTTCCTGAGTATTGTAGCCGGCATTCCGGTGATTAAACAAATCAACCAGATGCTGGGAGCCGTTCTCGGTTTTCTAGAAGTCTATTTATTTACATTTGTGCTGCTGTATGTCGCATCCGTTCTGCCGGTAGACGCGTTGCAGCAAATG------ATGGGGCAATCGTCTCTCGCAAATGTGATCATTAACCATACACCGTACTTGTCAGGGCTTTTACAAGAG
Q9K898_BACHD/1-172 ATGCTTAGTGTGATTTTATTGTTTATTTTGCTATGTAGCTTTTTTATCGGAAAGCGGAGGGGATTGATTTTACAGCTCGTACATCTCCTCGGCTTCGTTGCTGCGTTTTTTGTAGCTTACAAATACTATGCTCCAGTTGCTACCTACATTCGTTTATGGATTCCATACCCTCAATTTTCACCAGACAGCCCTGTGACGATGTTG------ATTGAAGCGTTTAACTTTGAAAATGTCTATTATTCTGGAATTGCGTTTGCCCTTCTTTTCATTGGAACAAAGATATTATTGCACATCGTCGGCTCGATGCTTGACTTTTTAACCCATTTGCCGATATTGCGCTCGGTTAACGGGTGGCTCGGGGGCATTCTCGGATTTGTTGAAGTGTATTTAATTATGTTTGTTCTCCTCTATGTTGGTGCATTGCTGCCGATCGAGACGGTGCAAACTCAT------TTAAACCAGTCGTTAGTCGCACAGTTTATCATGAACCATACACCATTTTTATCTGAGTTTATTCGCAAC
Q97SG6_STRPN/1-174 ATGATTTCATTCCTTCTTCTATTGGTCTTGGTTTGGGGATTTTATATCGGCTATCGGAGAGGCCTGCTCTTACAGGTTTATTACCTGATTTCAGCCATGGCATCGGCTTTTATGGCTGGCCAGTTTTATAAGGGGCTTGGAGAGCAATTCCATTTATTGCTCCCTTATGCAAATTCGCAGGAAGGTCAGGGGACTTTCTTTTTCCCATCGGATCAACTCTTTCAGCTGGATAAGGTCTTTTATGCAGGTATCGGCTACTTGCTTGTATTTGGGATTGTCTATAGCATTGGTCGTTTACTTGGTCTTCTCTTACACTTGATTCCTAGCAAAAAACTGGGTGGTAAGTTGTTCCAAGTTTCAGCAGGTATCTTGTCCATGTTGGTGACCTTATTTGTCTTGCAAATGGCCTTGACAATCTTGGCGACCATCCCCATGGCAGTTATACAAAATCCT------CTTGAAAAGAGTATCGTCGCAAAACACATCATCCAGAGCATACCGGTAACAACCAGTTGGCTCAAACAA
Q99Y72_STRPY/1-174 ATGTTATCTTTATTGATAGTGCTTATTTTAACTTGGAATTTTTATATTGGTTATAGTAGAGGTATTATTCTTCAATCGTTTTATGTCTTAGGAGCCCTACTTTCTCTTTTGGTAGCTAATCGATTTTATATTGGATTAGCCCATAAGCTAACGCTTTGGATTCCTTATTCTAACCCGGTAGAAGGAACATCAGTCTTTTTCTTTAAATCAGTTGATATCTTTGTTTTAGATAAGGTTTATTATGCAGGCCTTGCCTTTTTTATCATTTTCTTATTGGGGTATGCATTGAGTCGCTTTCTTGGGATTTTTGTTCATTTCCTTTTGCTAAATTATTTTGATAACCAGTGGACAAAATGTTTGAGTGGCGGACTAGCGTTTCTAGTATCGCTTCTTTTTTTGAACATGTTACTGTCTATTTTTGCAACGGTCCCTATGCCTTTTTTACAGCACTAT------TTGCACTCTAGTTTTCTTGCTCGTTTGGTGATCGAACACCTTCCACCATTGACAATAATTATTCAAAAA
Q9CF35_LACLA/2-173 ATATTAAATTTGATTATTTTAGTAGCCTTGGTTTGGGCTTTCATGGTTGGTTACTCACGAGGCTTGATTTTACAAGTCATCTACAGTTTTGGTACGATTATTGCGGCCTTCATTGCAGCCAGTAATTATAAAGAGTTAGCACAAAAATTGAGTATTTGGGTTCCTTTTTCAAATGCCACAGAAAACTCACATCTCTTACTTTTTAGTGATAAGCTTCTTTTTCAACTCGATGATGCTTTTTATGCGAGCATTTCGTTTTTAGCAATTTTTATTGTCGTTTATGCTATTATCCGTCTTATCGGTTTATTTTTACATTTTGCACTTAGT---CCT---CTGGGAAGAAATGGAAAAATCATTGCTGGAATTTTAGGATTTGCGGCGACTTATTTTGGTTTACAAATGGTCTTGATGGTCTTGAGTTTGGTTCCTATTGCAGCGGTTCAAAGTCAA------CTTGATGCTAGTTTTCTAGCTCGTTTTATGGTTTTACATACACCGATTTCATCAGGAATCTTGCAAAAC