EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02569 alignment
(7 sequences with 933 bp)


PANC_THENE/1-279 ATGAGAATCATAGAGACCATCGAAGAGATGAAGAAATTCTCTGAAGAG---ATGAGAGAAAAG------AAGAAAACAATCGGTTTTGTTCCCACCATGGGATATCTTCACGAAGGGCATCTTTCACTCGTGAGAAGGGCGAGG---GCAGAAAACGACGTGGTTGTGGTGAGCATCTTCGTGAATCCCACTCAGTTCGGTCCCAACGAAGATTACGAGAGATACCCGAGGGACTTCGAGAGGGACAGGAAACTTCTTGAGAAAGAGAACGTGGACTGCGTTTTCCATCCATCCGTGGAGGAGATGTATCCACCCGACTTCTCCACGTTCGTTGAGGAGACAAAG------------------------CTTTCAAAACCGCTGTGTGGTAGATCCAGGCCCGGACACTTTCGAGGGGTGTGTACCGTGGTCACAAAGCTCTTCAACATCGTGAAACCACACAGGGCGTACTTCGGTCAAAAAGATGCACAGCAGTTCAGGGTACTCAGGAGAATGGTGAGAGATCTGAACATGGACGTTGAGATGATCGAGTGTCCCATAGTGAGAGAACCAGACGGTCTTGCGATGAGTTCAAGAAACGTCTATCTCACACCTGAAGAGAGAAAACAGGCTCTTGCCCTGTACCAGTCGTTGAAAATCGCTGAAAACCTCTTTTTG------------AACGGTGAGAGGGATGCTGTGAAGATAAAGGAAGCGATGATCAATCATCTGTCCAGATTCGACAGA------GTGAAG---ATAGACTACGTGGAGATCGTCGATGAGGAAACG---CTGGAGCCCGTTGAAAAGATCGATCGAAAG---------------GTGATCGTCGCGGTCGCCGCCTGGGTGGGAAAG---------------------GCAAGACTGATAGACAACACGATACTG
PANC_AQUAE/2-280 CCACTCCTGTTTAAGAAAATTAAGGACTTGAGAAACTTCCTGAAAAAC---AAGAGGTGTGAA------GGAAAGGAAATAGGCTTCGTTCCCACCATGGGATACCTCCATGAAGGGCACAGACAGCTTATAAAACTCGCCAGA---ATGCAGAACGACATAGTTGTTGTGAGCATCTTCGTGAACCCGACTCAGTTCGGAGAGGGAGAAGACTACGACAGGTATCCGAGGGATCTGGAGAGAGACCTTGAAATCTGCGAAGAAGAGGGTGTTGACGTTGTATTTGCACCGGAAGTTGACGAAATATACCCGAAGGGCTATAGAACTAAGGTGTGCGTAGGGGAA------------------------CTCGGTAAGGTACTGGAAGGAGAGTTCAGACCGGGACACTTTGACGGAGTGGCTACGATAGTCGTAAAACTCTTTAACATAGTTCAGCCAAACAGGGCGTACTTCGGGGAAAAGGATTACCAGCAACTCAAGATAATAGAGCAGGTGGTGGAGGACCTCAACATTCCCGTTGAGATAGTTCCCGTGCCGATAGTGAGGGAAGAAGACGGACTCGCTTACAGCTCCAGAAACGTTTACCTCTCCCCAGAAGAGAGGGAATCAGCCCTTTCCATTTACAAGTCCTTCCTCCTCGCGGAGAAGATGATAAAG------------GCGGGAGAGAGGGATGCAAAAAGGATAAAGGAGGCGATAAGGGCTTTTATAGAGAGACACCCTCAC------GTTAAGGGAGTGGACTACGTGGAGATAACGGACCAGAAC------TTAAACCCGAAGGAAACTGTTGAGAAGGGG---------------GACAGAATTCTAGTCGCTGTAAGGGTAGGAAAT---------------------GCCAGACTCATAGACAACTGGAAGGTG
PANC_BACSU/1-278 ATGAGACAGATTACTGATATTTCACAGCTGAAAGAAGCCATAAAACAA---TACCATTCAGAG------GGCAAGTCAATCGGATTTGTTCCGACGATGGGGTTTCTGCATGAGGGGCATTTAACCTTAGCAGACAAAGCAAGA---CAAGAAAACGACGCCGTTATTATGAGTATTTTTGTGAATCCTGCACAATTCGGCCCTAATGAAGATTTTGAAGCATATCCGCGCGATATTGAGCGGGATGCAGCTCTTGCAGAAAACGCCGGAGTCGATATTCTTTTTACGCCAGATGCTCATGATATGTATCCCGGTGAAAAGAATGTCACGATTCATGTAGAAAGA------------------------CGCACAGACGTGTTATGCGGGCGCTCAAGAGAAGGACATTTTGACGGGGTCGCGATCGTACTGACGAAGCTTTTCAATCTAGTCAAGCCGACTCGTGCCTATTTCGGTTTAAAAGATGCGCAGCAGGTAGCTGTTGTTGATGGGTTAATCAGCGACTTCTTCATGGATATTGAATTGGTTCCTGTCGATACGGTCAGAGAGGAAGACGGCTTAGCCAAAAGCTCTCGCAATGTATACTTAACAGCTGAGGAAAGAAAAGAAGCGCCTAAGCTGTATCGGGCCCTTCAAACAAGTGCGGAACTTGTCCAA------------GCCGGTGAAAGAGATCCTGAAGCGGTG---ATAAAAGCTGCAAAAGATATCATTGAAACGACTAGC------GGAACC---ATAGACTATGTAGAGCTTTATTCCTATCCGGAA---CTCGAGCCTGTGAATGAAATTGCTGGAAAG---------------ATGATTCTCGCTGTTGCAGTTGCTTTTTCAAAA---------------------GCGCGTTTAATAGATAATATCATTATT
PANC_HELPY/1-276 ATGCGCGTGTTAGAAACGATTGTTGCTTTAAGAGAGTATCGTAAAAGT---TTGGAA---------------GAAAGCGTGGGGTTTGTGCCGACTATGGGGGCTTTACACAAAGGGCATCAAAGCTTGATAGAAAGGAGTTTG---AAAGAAAATTCCCACACGATAGTGAGCGTTTTTGTCAATCCCACGCAATTTGGGGCTAACGAAGATTTTAACGCTTACCCTCGCCCTTTAGAAAAGGATTTGGCTTTATGTGAAAAATTAGGCGTTAATGCGGTGTTTGTGCCTAAAATTGGCGAAATGTATCCCTATGAAGCAGAGCAACGCCTGAAACTCTATGCTCCT---------------AAATTTTTATCTAGCTCTTTAGAGGGAGCCATGCGTAAAGGGCATTTTGATGGGGTTGTTCAGATCGTGTTAAAAATGTTTCATCTTGTTAATCCCACTAGAGCGTATTTTGGCAAAAAGGACGCCCAACAGCTTTTAATCATTGAGCATTTAGTCAAAGATTTGCTTTTAGACATTGAAATAGCGCCATGCGAGATCGTGCGCGATGACGATAATTTGGCTTTAAGCTCTAGGAATGTGTATTTGAATGCCACACAAAGAAAACAAGCCCTAGCCATTCCAAAAGCTTTAGAAAAAATCCAGCAGGCCATAGAT------------AAGGGCGAAAAAGCGTGCGAAAAACTG------AAAAAA------CTAGGGCTTGAAATTTTAGAA------ACCTTGGAAGTGGATTATTTGGAATGTTGTAACCACAAG------CTAGAGCCTTTAACAATCATAGAGCCAACTAAC------------ACGCTCATTTTGGTGGCGGCTCGTGTGGGTAAA---------------------ACCAGGCTTTTAGATAATTTATGGGTG
PANC_MYCTU/11-285 CTCAATGTGTACTCGGCACCGGGGGATGTCGCCGATGTCAGTCGCGCA---CTGCGACTCACC------GGCCGGCGAGTGATGTTGGTGCCTACTATGGGTGCGCTGCACGAAGGCCACCTCGCGTTGGTGCGTGCGGCCAAGCGGGTGCCCGGATCGGTCGTCGTCGTGTCGATCTTCGTCAACCCGATGCAATTCGGTGCCGGGGAAGATCTCGACGCCTATCCCCGCACCCCGGACGACGACCTGGCGCAACTGCGGGCCGAAGGCGTGGAAATCGCTTTCACGCCAACTACCGCGGCGATGTATCCCGACGGCCTGCGCACCACCGTGCAA---------CCC---------------GGTCCGTTGGCCGCCGAACTCGAGGGCGGCCCGCGGCCAACCCATTTCGCCGGCGTGCTGACGGTCGTGCTAAAGCTGCTGCAGATCGTGCGCCCGGATCGGGTGTTCTTCGGTGAGAAGGACTACCAGCAGCTGGTGCTGATCCGGCAGCTGGTCGCGGACTTCAACCTCGATGTCGCGGTGGTCGGCGTGCCGACCGTGCGCGAAGCCGACGGGCTGGCGATGTCGTCGCGCAACCGCTACCTGGACCCGGCCCAGCGTGCGGCGGCCGTCGCGCTCTCGGCGGCGCTAACGGCCGCAGCGCATGCGGCAACG------------GCTGGC---------GCGCAGGCCGCGCTGGATGCCGCCCGT---GCGGTGCTCGACGCTGCACCC------GGCGTGGCGGTCGACTACCTGGAGCTGCGCGATATCGGG------CTTGGCCCGATGCCGCTCAACGGTTCCGGT------------------CGGCTGCTGGTTGCTGCCCGGCTTGGCACC---------------------ACCAGGCTGCTGGACAACATTGCGATT
PANC_ECOLI/2-280 TTAATTATCGAAACCCTGCCGCTGCTGCGTCAGCAAATTCGCCGC------CTGCGTATGGAA------GGCAAGCGCGTGGCGCTGGTGCCTACCATGGGTAACCTGCACGATGGCCATATGAAGCTGGTCGACGAAGCCAAA---GCCCGCGCCGATGTGGTCGTCGTCAGTATTTTCGTTAACCCGATGCAGTTCGACCGCCCGGAAGATCTGGCTCGTTATCCACGGACCTTGCAGGAGGACTGCGAGAAGCTAAACAAACGTAAAGTGGATTTAGTTTTCGCCCCTTCGGTAAAAGAGATCTACCCGAACGGTACTGAAACCCACACTTACGTTGACGTTCCT---------------GGC---CTTTCGACCATGCTGGAAGGTGCCAGCCGTCCGGGACATTTTCGCGGCGTTTCGACTATTGTCAGCAAGCTGTTCAACCTGGTCCAGCCGGACATCGCCTGCTTCGGTGAAAAAGATTTTCAGCAACTGGCGCTGATCCGCAAAATGGTTGCCGATATGGGCTTCGATATTGAGATTGTCGGTGTGCCAATTATGCGCGCCAAAGACGGTCTGGCGCTAAGTTCCCGTAACGGTTATCTGACGGCGGAACAACGCAAAATTGCGCCTGGTCTGTACAAAGTTTTAAGTTCGATTGCTGACAAATTGCAG------------GCTGGGGAACGGGATCTCGATGAAATTATTACCATTGCGGGG---CAAGAACTGAATGAAAAA---------GGCTTCCGCGCCGATGATATTCAGATTCGCGATGCCGACACATTGCTGGAAGTTTCTGAAACCAGCAAACGGGCA------------------GTAATTCTGGTAGCCGCCTGGCTTGGCGAT---------------------GCTCGCCTGATCGACAACAAAATGGTC
PANC_YEAST/37-345 ATGAAAATCTTCCATACTGTCGAAGAAGTTGTTCAATGGAGAACACAGGAGCTGAGGGAAACTAGATTTAGAGAAACTATTGGGTTCGTTCCCACAATGGGTTGCCTGCATTCGGGTCACGCTAGTTTGATCTCGCAGTCTGTG---AAGGAAAACACCTATACTGTGGTCAGTATATTTGTAAATCCCTCCCAGTTTGCGCCAACGGAAGATCTAGATAACTATCCTCGAACTTTGCCAGACGACATCAAATTGCTTGAGTCGTTGAAGGTGGATGTTCTATTTGCTCCTAATGCACACGTGATGTATCCACAGGGAATTCCGCTCGACATAGAAGAGCAGAAAGGCCCTTTTGTTAGTGTTCTTGGATTGAGTGAAAAATTAGAGGGGAAGACGAGACCTAACTTCTTTAGGGGCGTGGCAACTGTCGTGACTAAACTATTCAATATCGTTATGGCGGATGTGGCTTATTTTGGGCAGAAGGACATTCAACAGTTCATTGTTTTACAGTGTATGGTGGACGAACTGTTTGTTAATACAAGGCTACAAATGATGCCTATTGTAAGAAACAATAATGGACTGGCTCTGAGTAGTAGAAACAAATATCTTTGTCCAGAGTCTTTAAAGATCTCTGAAAACCTTTACCGCGGGCTGAAAGCTGCGGAAAATGCTATTAGGAGACTAGCACCAGGGGGACGTCTCTCCAGATCAGAAATCATCGATACTGTGACTCAAATATGGGCACCCTACGTTGATTCCCACGATTTCAAAATCGACTATGTTTCCTTAGCAGATTTTAAGACT---CTTGATGAACTCTCCGATGTTGAAAACACCAGCGAACAGCAGCCAATAGTCATTAGTTGTGCTGTATACGTGACTGACCGCGAAAAACCCGATACGGTCGTCAGACTAATAGATAACATCGTTATT