EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02524 alignment
(28 sequences with 33 bp)


O50842_BORBU/79-89 AAGGTAGAAAAAGTAAGAAGTGAGCTTTCTGCA
O87446_BORTU/54-64 AAACTTGAAAAGGTTGAAGCTCTTCTACAAGCT
O87446_BORTU/189-199 AAGATTGAAAAGGTAGAATCAACCTTACAAGCT
P70812_BORAF/64-74 AAGAATGATAGTGTAGGAAAGAATTTAGACCCT
O50671_BORBU/63-73 GAGATTTCTTTTTTAGAAAAGAATTTACAAAAA
O07494_BORBU/46-56 AAAATAATCGATTTAGAAAAGAATTTGAGAAAA
Q45025_BORBU/46-56 AAATTGATTAATGTAGAGAAGAATTTGCAAAAA
O07494_BORBU/104-114 AAGATAAATAATGTAGAAAAAACTTTACAAAAA
Q45025_BORBU/165-175 AAGATAGATAGTGTAGAAAAAGGGTTAAACGAA
Q44866_BORBU/133-143 AAAATAGACAATGTAGAAAAGAGTTTAAATCAA
O87446_BORTU/127-137 AAAATTGATAACGTTGAGAATAATCTTAACATA
Q44804_BORBU/176-186 AAAATAGACAATGTTGAAAAGAATTTATGTCTC
Q44814_BORBU/151-161 AAAATAGATACTGTAGAAAAGAATTTAAATGCC
O50671_BORBU/153-163 AAGATAGATTCTGTAGAAAAGAATTTACAAAAA
Q44809_BORBU/111-121 AAGATTGATGCCGTAGAGAAGAATTTACATGTT
P70812_BORAF/104-114 AAAATCGATTTCGTAGAAAAGAATTTAGAGACT
O07494_BORBU/75-85 AAAATAGATACTATAGAAAAAAGTTTAAATCTA
P70812_BORAF/140-150 AAGATTGATACCGCAGAAAAGAATTTAAAAAAA
O87446_BORTU/200-210 GAGATTCAAAGGGTTGAGACAACTTTAAAATCT
O50842_BORBU/108-118 AGAATAGAAAAAGTAAGAAGTGAGCTTAAGGGT
O50842_BORBU/90-100 GAGATAAAGACAGTAAGAAGTGAGCTTAAGGGT
O87446_BORTU/109-119 AAAATAGATAATGTCAGAACTGAATTAAAATCT
O87446_BORTU/65-75 GAGATTAAATCTGTTAAAACCGAACTTGATAAC
O87446_BORTU/167-177 AAAATAGATTCTAAATTTAATGAACTCGATAAC
P70812_BORAF/115-125 AAAATAGATGGTTTAAAGAATGAATTTAATGCC
O51013_BORBU/60-70 AAGATTGATACTGTTAAAAGTGAACTTACTACT
Q44799_BORBU/122-132 AAAATAGATAGTGTTAAAAGCGAACTTAATGCT
Q45025_BORBU/147-157 AAAATAGATAATGTAAATAATAAAGTAGATTAT