EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02144 alignment
(3 sequences with 540 bp)


REC1_USTMA/239-418 AAACTCAGCTATCAAGGTCATGGTAATCCACTCGTTCTCGAGCTTGAGCAAGACGCCAACGTATTGACGCGTGTATCTATGTCGACATACGAACCCAGCTTCCTCACAGATATGGTCTTTGAACCGCAGAATATGGTGGCTCAAGTCATTGTTGCATCCGAGCTCATGCAATCTGCCTTTACTGAGATTGATGCCAGCTGCAAGAAACTCTCGATCCTCATCACATCGCCCCACTCATTATCGACGTATGACGGTGATCAGCGCACAGAGGCTCCGGCACCCACCAAGAGGAACACTTCAGCCAGCATGCTCAAGTTCAGGGCCATCTCGGATACCGGATCGTCACAAATGGAGTTCCCAGCCAGTCTCACCTCATCTGACCCTACGGGCGTTATAGAGAAATTCGTAGCCCTGCCTGGCAGCAGCGAACAATGGTACGACTTCACATTGCTCTCACGAACCATGTCTGTCTTGCGATCGTCGATAAAGACCTCTCTCCGAATGGACGAGGCTGGTCTCATTAGCTTTCAGTTTATGATG
O70452_MOUSE/109-257 CGGATGTGTTACCAAGGTTATGGTCACCCACTGATGCTATTTCTAGAAGAAGGAGGA---GTGGTGACGGTCTGCAAAATTACCACTCAGGAGCCTGAGGAGACACTGGATTTTGATTTCTGCAGCACCAATGTTATGAATAAAATTATCCTGCAGTCAGAGGGGCTCCGGGAAGCCTTTTCTGAGCTGGACATGACAGGTGATGTCCTACAGATCACTGTGTCTCCTGACAAGCCCTATTTCAGGTTGTCT------------------------------ACTTTTGGAAATGCAGGAAACTCCCATCTTGACTATCCCAAAGATTCCGACTTGGTGGAAGCCTTTCACTGTGATAAGACCCAGGTCAAC------------------------------------------------------------AGATACAAGCTGTCGCTACTGAAGCCTTCTACAAAGGCACTAGCTTTATCCTGTAAAGTGTCTATCCGGACAGATAACCGAGGCTTCCTCTCCTTACAGTACATGATT
RAD1_SCHPO/113-263 AAAGTACAGTATAATGGACCCGGCTGTCCATTTATATGGGAAGTAGAGGAAATGGCTGGTTATGCTACGGCTTGTGAACTGTTGACTATGGAATGTGAGGACGACGTTGACATCAATAGACTTGCAAGCACATTGTGCACGAAGATCATTATGAAAAGTAACTGGCTATATGATGCCTTGGTGGAATTAGACAATAACATGGGCGAAAATTTAATTATTCATACATCATCCCAAAAATCAACCTTCTTATTGAGA---------------------------TGTGTAGGGGCATTATCCACTACGGAAATAGAATATCCAAACGAGAAAAGTGTTTTAGAGTCTTTTGAAACTGATTCTGAAAACACTTAT------------------------------------------------------------TCCTACCGCTTCTCATTAATAAGACATGCGCTGAAAGCATTACAAGTGGGTTCTAAAGTAAACCTACGTATTGATGAAAATGGAACTTTGAGCATTCAAATCATGCTT