EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02083 alignment
(2 sequences with 36 bp)


UTS2_RANRI/116-127 GGAAATCTGTCCGAATGTTTCTGGAAATACTGTGTC
UTS2_HUMAN/113-124 CGTGAGACTCCTGATTGCTTCTGGAAATACTGTGTC