EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02068 alignment
(3 sequences with 240 bp)


Q9ZTM1_PETHY/10-88 ATCTGCGACGAAAGGTGTGGCTGTCCATCTCCCTGCCCTGGTGGTGTTGCTTGCAGGTGTGCGTCAGGAGGGGCGGCGACAGCAGGTGGGGGGGATATGGAGCACAAGAAATGCCCATGTGGAGAACACTGCGGATGCAATCCATGCACATGTCCAAAGAGTGAGGGCACCACTGCTGGTAGTGGCAAG---GCTCACTGCAAGTGCGGTCCTGGCTGCACCTGTGTCCAGTGTGCCTCT
EC1_WHEAT/1-77 GGCTGCGACGACAAGTGCGGGTGCGCCGTGCCGTGCCCCGGCGGCACGGGCTGCAGGTGCACCTCGGCGAGG---------AGCGGCGCGGCGGCGGGGGAGCACACGACGTGCGGGTGCGGCGAGCACTGTGGGTGCAACCCGTGCGCGTGCGGGCGCGAGGGGACGCCGTCCGGGCGGGCGAACAGGAGGGCCAACTGCTCCTGCGGCGCGGCCTGCAACTGCGCTTCATGCGGCTCG
EC_MAIZE/1-75 GGGTGCGACGACAAGTGCGGGTGCGCCGTGCCGTGCCCCGGCGGCAAAGACTGCAGGTGCACGTCGGGG---------------AGCGGCGGGCAGCGGGAGCACACGACTTGCGGCTGCGGGGAGCACTGCGAGTGCAGCCCGTGCACGTGTGGCCGGGCCACGATGCCGTCCGGCCGCGAGAACAGGAGGGCTAACTGCTCCTGCGGGGCGTCCTGCAACTGCGCATCCTGCGCCTCG