EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02055 alignment
(3 sequences with 1506 bp)


O16581_CAEEL/68-560 GCCAATGATTGCGCCCAAAAAACCTTC---AAAACCGGAATTGTGTGTGTCTGCAACATAACTTATTGCGATGAGATC---CCAGATATCAACTTACTATCCGGGCAGGCTGCCACATTCACAACTTCCAAATCCGGAGCCCGACTGCATCGGGATGTGGTTTATGCGACAAATAGTGACCCTTTAACCAGCATGCACTTCACAATTGACTCGTCAAAAACATATCAGACAATCCAAGGATTTGGCTCAACGTTTTCCGATGCTTCTGGTGCGAATTTGAAGAGCTTACCCGATCAGATGGCTGATACAATTCTGAGACAGTATTTTTCGGATTCTGGCCTGAACCTGCAATTCGGACGGGTTCCAATTGCCAGCAATGACTTTTCAAGTCGTGTCTACACTTATGACGATAACCTTGAAGACTACAATATGGCACATTTTAGCCTGCAAAGGGAAGACTATCAGTGGAAGATTCCGTATATGCAAATGGCGCAGAAGTACAACCACGAT---TTGAAGTTTTTCGCCGTGCCGTGGAGTGCGCCAGGCTGGCTAAAAACCACGAATTCCACCAAAGGGTACGGTATCCTACTAGGCACCAATCAAGACACCTACCACAAATCCTACGTCACTTATATCTTACATTTCTTGGAAGAATATCAGAAAAATGGGATTCTCTTCTGGGGCTTGTCAACTCAAAATGAGCCAACTAGCGGAAGTGATAAGAAGACTAAAATGCAATCAATGGGATTCACGGCGGAATTTCAAAGAGATTTTATTAAGCTTGACATTGGACCAGCGCTGAAATCTTCGAATGCTGGAAAAAATGTGAAAATTCTGATTTTGGACGATAATCGTGGAAACTTGCCAAAATGGGCAGACACTGTTCTCAATGACAAGGACGCAGCAAGTTACGTCTCCGGAATCGCCGTACACTCTTACCAGGAC------GACGAAAGTGACAAACATCTTACACAAACCCACAATAACCACCCAGATGTGTTCATTTTTGGTACAGAGGCAAGCGAGGGGTCTAAATCGAAGGAT------GTGGATTATGGTAGCTTCGATCGAGCAGAAGACTATGTTTCGGACATTTTAGATGATTTCAATAATTGGGTTACCGGATGGACGGAGCGTAACCTGGTGCTAGATGCTCAAGGTGGACCGTCCTGGGTTTCGGGATTCGCGGATGCTCCGGTCATTGCGTTCCCCGCATTGGCTCAATTCTACAAGCAGCCCATGTTTTATGCAATTGCACATTTTAGTCATTTTCTGAAGCCCGGAGCAGTTCGAATCGACCATTCACTGAACATGCCAAACCCAGAAATTGAACGAAGTGCATTTTTGAATCCGGATGGCTCAAAAGTCGTGGTGCTCCATAATAAAAATCCTTTGGCACCA------TATAGTTTATCAATTAAGGATACTATGAAGTCTACTGATCATTATCAAGTTCATTTATCACCTAAAACAATTGTTACGTTGTATATTCAA
O16580_CAEEL/23-519 GCAGCTGATTGTACGGAAAAAACATTT---AAAACCGGAACAGTATGCGTTTGTAGTCTCGATTCTTGCGATGAGATT---CCACCTCTGGACATCACTATGGGTCAGGCGGCACTCTACACCACCTCCCATACCGGCGCCCGGCTCCACAGGGATGTCATCTATGCGACGGATACTGAGCCATTCGGAACCCTGCACATGACAATTGACTCCTCCAAAAAATACCAGACGATCCAAGGATTTGGCTCCACATTTTCCGATGCTTCTGGTGCAAACCTGAAGAGTTTGCCGGACAAATTGTCGGATTTGATTATGAAACAATATTTTTCGGATACAGGACTTAACCTCCAATTCGGTAGAGTTCCAATAGCCAGCACAGATTTTTCGGGTCGAGTTTACAGTTATAACGATGTCGCAAATGATTATTCAATGCAGAATTTTAATTTGACTAAGGAAGATTTCCAGTGGAAAATCCCATACATCAAAAACGCGCAGAAGTACAATCCGAAC---TTGAAGTTATTTGCAGCTCCGTGGGCAGCACCAGGATGGCTTAAGACTACTAAAGAAATGACAGGACCTGGGGCTCTTAACGGAAAAGCTGGGGATAACTATCATCAGGCATACGCCAAATATTTTGTCAGATTCCTCGAGGAGTACGGAAAATCTGGAATCTCATTCTGGGGACTTTCAACTCAAAACCAGCCAACATTAGGCTCCGATAAGAAGAATAAAATACAATCGACACTTTTCACAGCTGAAACACAACGAGATTTCATAAAAACTGACTTGGGACCAGCCCTGGCTGCTTCAAGTTCTGGAAAAGATGTGAAACTTCTGATTCTGGACGATAATCGAGGAAACTTGCCGAAATGGGCAGATACTGTTCTAAACGACATGGACGCCGCAAAGTACGTGGGCGGTATCGGGGTTCACGCATATCAAGAC------GGAGAAACTGATAATCACTTGGATGAGACTCACAAAAAACATCCAAATTTTTTTATTTTAGGCACTGAGGCTTCCGAAGGCTACGGGTCCAAGGACACCCACGTGGATTATGGAAATTGGGATCGTGCAGCAGATACTGCTTCAGATATTTTAGATAACATGAACAACTGGATGACTGGCTGGACAGAACGTAACCTAATCCTAGACGCCCTGGGTGGTCCATCATGGGTGTCCGACTACACAGATGCGCCGGTCATTGCGTTCCCAGCGATGGCTCAATTCTACAAGCAGCCCATGTTTTATGCGATTGCACATTTTAGTCACTTCATCAAGCCTGGAGCAGTAAGAATCGACCACTCATTAAATGTAATTGAGCTGGAAGTTGAAACCACCGCATTTTTGAATCCTGATGGCTCAAAAGTTATTGTAATGCTCAATAAGGGCTCGCTAGTCTCAACGGAGCACACAGTAGTTGTCCAGGATGCTGCTGATAGCCGTAATCACTATCATTTTACACTTCCACATCGAGCTATTACCACTTTGTATATTCAA
GLCM_HUMAN/40-533 GCCCGCCCCTGCATCCCTAAAAGCTTCGGCTACAGCTCGGTGGTGTGTGTCTGCAATGCCACATACTGTGACTCCTTTGACCCCCCGACCTTTCCTGCCCTTGGTACCTTCAGCCGCTATGAGAGTACACGCAGTGGGCGACGGATGGAGCTGAGTATGGGGCCCATCCAGGCTAATCACACGGGCACAGGCCTGCTACTGACCCTGCAGCCAGAACAGAAGTTCCAGAAAGTGAAGGGATTTGGAGGGGCCATGACAGATGCTGCTGCTCTCAACATCCTTGCCCTGTCACCCCCTGCCCAAAATTTGCTACTTAAATCGTACTTCTCTGAAGAAGGAATCGGATATAACATCATCCGGGTACCCATGGCCAGCTGTGACTTCTCCATCCGCACCTACACCTATGCAGACACCCCTGATGATTTCCAGTTGCACAACTTCAGCCTCCCAGAGGAAGATACCAAGCTCAAGATACCCCTGATTCACCGAGCCCTGCAGTTGGCCCAGCGTCCCGTTTCACTCCTTGCCAGCCCCTGGACATCACCCACTTGGCTCAAGACCAATGGAGCGGTGAATGGGAAGGGGTCACTCAAGGGACAGCCCGGAGACATCTACCACCAGACCTGGGCCAGATACTTTGTGAAGTTCCTGGATGCCTATGCTGAGCACAAGTTACAGTTCTGGGCAGTGACAGCTGAAAATGAGCCTTCTGCTGGGCTGTTGAGTGGATACCCCTTCCAGTGCCTGGGCTTCACCCCTGAACATCAGCGAGACTTCATTGCCCGTGACCTAGGTCCTACCCTCGCCAACAGTACTCAC---CACAATGTCCGCCTACTCATGCTGGATGACCAACGCTTGCTGCTGCCCCACTGGGCAAAGGTGGTACTGACAGACCCAGAAGCAGCTAAATATGTTCATGGCATTGCTGTACATTGGTACCTGGACTTTCTGGCTCCAGCCAAAGCCACCCTAGGGGAGACACACCGCCTGTTCCCCAACACCATGCTCTTTGCCTCAGAGGCCTGTGTGGGCTCCAAGTTCTGGGAGCAGAGTGTGCGGCTAGGCTCCTGGGATCGAGGGATGCAGTACAGCCACAGCATCATCACGAACCTCCTGTACCATGTGGTCGGCTGGACCGACTGGAACCTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCCCATCATTGTAGACATCACCAAGGACACGTTTTACAAACAGCCCATGTTCTACCACCTTGGCCACTTCAGCAAGTTCATTCCTGAGGGCTCCCAGAGAGTGGGGCTGGTTGCCAGTCAGAAGAAC---GACCTGGACGCAGTGGCACTGATGCATCCCGATGGCTCTGCTGTTGTGGTCGTGCTAAACCGCTCCTCTAAGGATGTGCCT---------CTTACCATCAAGGATCCTGCTGTGGGC---------TTCCTGGAGACAATCTCACCTGGCTACTCCATTCACACCTACCTGTGG