EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF02044 alignment
(12 sequences with 42 bp)


Q90253_BOMOR/49-62 GGGAATCAGTGGGCAGTTGGTCACTTCATGGGTAAGAAGAGC
NEUB_XENLA/45-58 GGAAATCAGTGGGCAATTGGGCATTTCATGGGTAAAAAGAGC
NEUB_HUMAN/47-60 GGCAACCTCTGGGCCACCGGTCACTTCATGGGCAAGAAGAGT
GRP_SHEEP/41-54 GGCAACCACTGGGCGGTCGGACACTTAATGGGAAAAAAGAGT
GRP_HUMAN/41-54 GGCAACCACTGGGCGGTGGGGCACTTAATGGGGAAAAAGAGC
BOMB_BOMVA/46-59 GGGAATCAGTGGGCAGTGGGTCACTTGATGGGTAAGAAGAGC
BOMB_BOMOR/49-62 GGGAATCAGTGGGCAGTGGGTCACTTGATGGGTAAGAAGAGC
GRP_BOMOR/51-64 GGCAGTCACTGGGCTGTGGGGCATCTCATGGGTAAAAAGAGT
GRP_RAT/43-56 GGCAGCCACTGGGCTGTAGGACACTTAATGGGGAAGAAGAGC
RANA_RANPI/49-62 GTACCTCAGTGGGCAGTTGGACACTTTATGGGTAAGAGAAGC
LITL_PHYSA/48-61 AGACAACTTTGGGCAGTTGGGAGCCTCATGGGTAAGAAGAGC
LITP_PHYSA/48-61 AGACAACTTTGGGCAGTTGGGAGCTTCATGGGTAAGAAGAGC