EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01930 alignment
(6 sequences with 258 bp)


O27157_METTH/91-175 ATGGAGGAGGCCCACAGGTTCCAGCTTCTATATTATCTATTCTACCTAAAAAATGAAAAGGGAATAGAAAAGATCAGGGGATTCATTGACTACCCAGCTCTTAAAAAGAGAACCGAGGTTTCACTTAGTGCTGAAGATGAAGAGGAACTTCGTAGAGTGATCCATGAAATTGATAGGATAATAATGGGACCT---CCACCAGCCCCCCAGAGAAAACCCATCTGCAGAAGCTGCGCTTACTTTGAACTCTGCTGGGCT
O74003_PYRHO/1-83 ATGGAGAAGGCCCACGAGATGCAGACCCTCTACTATCTTTATTACCTTAAG---AAGCATGGGATAAAG---GCCAAAGCGATACTGCACTACCCAAAGCTAAACGAAAAAAGAGAGATCGAACTTGAGGGTAGGGAAAAAGAG---GTTGAGGATGCTATAATTCAAGTTGAAGTTATAAAATCATCCCCAAAGCCACCTAAGCCGAGGAAGAGTAAAATTTGCAAGAAGTGCGCGTATAGGGAGCTCTGCTGGGGG
Y377_METJA/87-170 ATGGAGAAAGCCCATATAATGCAGGTATTGTATTACATCTATTATTTAAAC---AGTTTAGGAATAAAA---TCTAAGGCAATCCTTCATTATCCAAAACTTAAGGAGATTAAAGAGATTGAGTTAAAAGAAAATAACAAAGAGGAAATAAAAAGAGCAATAAAAGAGATTGAATACATAAAATCATTAAAAGAACCACCAGAGCCTATTTATCAGAAGATTTGCAAGAATTGTGCTTATTATGAATTATGTTTTATT
O30235_ARCFU/85-167 ATGGAGAAGGCCGACTATTATCAGCTTGCCTACTACCTTTACTACCTCTCA---AAGCACGGTGTTAGG---GCGAGGGGGAGGATAAGCTATCCGAAGAGCAGGAAAAATGTAAGTGTGGAGCTGGACGAGAATTTACTGGTGAAGTTGAAAAGCATTCTTGAAGAGATTAAGGCAATCAAGAGCTCATCA---ATGCCAAAGCCTGAGAAGAAGAGCTACTGCACGAAGTGCGCCTACTACGAGCTGTGCTTTTCG
O57914_PYRHO/79-162 CTAGAGGAACCTGCAAAATGGCAACTCAAGTACTACCTTTACTACCTGAAG---AAGGCCGGAATTGAT---GCAATTGGGGTAATCTCCTATCCCAAGGAGGGTAAGAGGGAGATTATTGAGCTGAAAGAGGAGAACATTAAGGTGATTGAGGAAGCTATTAAGGGTATTGAGGAAGTTGTTTCCTCCCCAAAGCCTCCAAAGCCTGTTAAAAAACCTTACTGTAGGAAGTGCTCTTACAGGGATCTATGCTGGGTG
O66693_AQUAE/93-177 CTAGAAGAGGCCCATGTCCTTCAAGTCAAGTATTACCTCTGGTTTTTAGAA---AAATCAGGCGTAAAAGTCAGCCACGGTATAATCCACTATCCCAAGCAGAGAAAAGTTCTGAGGGTAGAACTCACTCAGGAAGATAGAAAGGTAATCGTAGAAGCCCTTGAAAACATTCAGAAAGTTCTCTTGGAAGAAAAACCACCCGAAGTTATTAAAAAGCCCTATTGCAAGAAGTGCGCCTATTACGAGTTTTGCTATGGG