EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01868 alignment
(6 sequences with 276 bp)


RNP1_PYRHO/37-123 AGAGTAACGAGAAGAAATATAATTTGGCATGAGCTCATAGGATTGAGGGTCAGGATAGTTGGCTCTACGCATCCAGCATTCGTAGGGATTGAAGGTTACGTAATTGATGAGACCAGAAACATGTTAGTGATAGCTGGAGAC------AGAATTTGGAAAGTCCCTAAGGATGTATGTATATTTGAGTTCGAGGCTGATGAT---------GGGACAAAGATTAAAATACCCGGGGAAAGATTGGTTGGCAGACCTGAGATGAGACTGAAAAAGAGG
RNP1_METJA/1-88 ATGATAACTCCTCACAATATATTAAGGCATGAACTTATAGGGCTTAAAGTAGAGATTGTTGAAGCGAAGAACAAAGCGATGATAGGGATTAAAGGGAAAGTAGTGGATGAAACAAGAAATACATTAGTGATAGAAAAAGAGGATGGTAGGGAAGTAGTAATCCCAAAAGACATTGCAGTGTTTCTCTTTCAACTAAAGGGG------------TGCAAAGTAAAGGTCGATGGGAGATTGCTAATAGGGAGACCAGAAGAGAGATTAAAGAAAAAA
RNP1_METTH/1-89 TTGATAACCCCCAGGAATATTTTCAGGCATGAGCTTATTGGCCTTTCTGTGAGAATAGCCAGGAGTGTTCACAGGGACATTCAGGGAATATCGGGAAGAGTCGTGGATGAAACCAGGAATACCCTTAGAATCGAAATGGATGACGGCCGGGAAATAACGGTTCCAAAGGGAATAGCCGTCTTCCATTTCAGAACACCGCAG---------GGTGAACTTGTTGAGATTGATGGTAGAGCTCTGGTGGCTCGTCCTGAGGAGAGAATAAAGAAGAAA
RNP1_METVA/1-92 ATGAAATTCTCACAAAATATATTGAGACATGAACTAGTTGGATTAAATCTTGAAATTGTAAATTCTACAGATAAAAGATTAATTTCAACAAAAGGGAGAGTAATAAACGAAACCAGAAATATGCTGGTTATCGAAAAAAATAATGGTAAGGAAATTACCGTTCCAAAAGAAATTTCGATATTTCGATTTGAATTTTCAGATTTGGATACCCCTAAAAAGGTAGATATTGATGGAAGACTTCTTATTGGAAGGCCTGAAGACAGGCTAAAAAGGAAA
RNP1_HALMA/2-88 CCACTAACACCCGAGACGCTCCCACGACACGAACTCGTCGGCCTCGACTGCGAGGTCGTCGCGGCGTCCAATCCGGATGTCATCGGTATCAGCGGAACTGTCGTCATGGAGACGACACAGATGCTGACACTCGAGGGGGCCGAC---CGGGTGTGGCACGTGCCGAAGGACAGCGCGACGTTCGCGTTCGACCTGTCGACC------------GAGACGGTTCTCGTCGACGGCGACCGCCTCGTTGCCCGTCCCGCTCGTCGCACAGAGAACACA
RNP1_ARCFU/4-90 AGGCTACAGGGTGTAGAGCTGATAGCGAGGGACTGGATTGGCCTGATGGTGGAAGTGGTGGAGAGTCCAAACCACAGCGAAGTGGGGATAAAGGGAGAAGTGGTTGATGAGACTCAGAACACGCTCAAAATAATGACTGAAAAA---GGTTTAAAAGTCGTGGCGAAGAGAGGTAGAACCTTCAGAGTGTGGTATAAGGGT------------AAAATCATGCGGATAAAGGGTGATCTGATAAATTTCAGGCCGGAGGATAGGATAAAGAGAGGT