EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01775 alignment
(6 sequences with 525 bp)


RL20_YEAST/5-174 CATTTCAAAGAATACCAAGTCATTGGTCGTCGTTTACCAACTGAATCCGTTCCAGAACCAAAGTTGTTCAGAATGAGAATTTTTGCTTCAAATGAAGTCATCGCCAAGTCTCGTTACTGGTATTTCTTGCAAAAATTGCACAAGGTTAAGAAGGCTTCTGGTGAAATTGTTTCCATCAACCAAATCAACGAAGCTCACCCAACCAAGGTCAAGAACTTCGGTGTTTGGGTTAGATACGATTCCAGATCTGGTACTCACAACATGTACAAGGAAATCAGAGACGTATCCAGAGTTGCTGCCGTCGAAACCTTATACCAAGACATGGCTGCTAGACACAGAGCTAGATTTAGATCTATTCACATCTTGAAGGTTGCTGAAATTGAAAAGACTGCTGATGTCAAGAGACAATACGTCAAGCAATTCTTGACCAAGGATTTAAAATTCCCATTACCTCACAGA------------GTCCAAAAATCT---ACCAAGACTTTCTCTTACAAGAGACCATCAACCTTCTAC
RL20_SCHPO/1-175 GCACTCAAGGAGTATCAAGTCGTTGGACGCAAGGTTCCTACGGAACATGAGCCTGTTCCCAAGCTATTCCGTATGCGTTTGTTCGCACCTAATGAATCTGTTGCCAAGTCTCGTTATTGGTACTTCTTGAAGATGATCAACAAAGTCAAGAAGGCCACTGGTGAGATCGTTGCCATCAATGAGATTTCCGAGCCTAAGCCGTTGAAGGCCAAGGTCTTCGGTATCTGGATTCGTTATGACTCTCGCTCTGGTACCCACAACATGTACAAGGAGTTCCGTGACACTACTCGTGTTGGTGCCGTTGAGGCTATGTATGCCGATATGGCTGCCCGTCATCGTGCTCGTTTCCGCAGCATCCGTATCCTTAAGGTTGTTGAGGTTGAGAAGAAGGAGGACGTTCGCCGTAACTATGTCAAGCAACTCCTTAACCCTCACTTGAAATTCCCTCTCCCTCACAGACGTACTGGTGTTGTCGGTTTGGCTGGCAAGAAGGTCTTTGCTCCTCACCGTCCCAGTACTTTTTAC
RL18A_HUMAN/6-176 ACGCTACGAGAGTACAAGGTAGTGGGTCGCTGCCTGCCCACCCCCAAATGCCACACGCCGCCCCTCTACCGCATGCGAATCTTTGCGCCTAATCATGTCGTCGCCAAGTCCCGCTTCTGGTACTTTGTATCTCAGTTAAAGAAGATGAAGAAGTCTTCAGGGGAGATTGTCTACTGTGGGCAGGTGTTTGAGAAGTCCCCCCTGCGGGTGAAGAACTTCGGGATCTGGCTGCGCTATGACTCCCGGAGCGGCACCCACAACATGTACCGGGAATACCGGGACCTGACCACCGCAGGCGCTGTCACCCAGTGCTACCGAGACATGGGTGCCCGGCACCGCGCCCGAGCCCACTCCATTCAGATCATGAAGGTGGAGGAGATCGCGGCCAGC---AAGTGCCGCCGGCCGGCTGTCAAGCAGTTCCACGACTCCAAGATCAAGTTCCCGCTGCCCCACCGG---------GTCCTGCGCCGTCAGCACAAGCCACGCTTCACCACCAAGAGGCCCAACACCTTCTTC
RL18A_DROME/6-176 TTGTTGAAGGAGTACGAGGTCGTGGGCCGCAAGTTGCCCAGCGAGAAGGAGCCCCAGACTCCCCTCTACAAGATGCGCATCTTTGCCCCCGACAACATCGTGGCCAAATCCCGCTTCTGGTACTTCCTGCGCCAACTGAAGAAGTTCAAGAAGACCACCGGCGAGATCGTGTCCATCAAGCAGGTGTACGAGACGTCGCCCGTGAAGATCAAGAACTTCGGCATCTGGCTGCGTTACGATTCCCGCTCGGGCACCCACAACATGTACCGCGAGTACCGTGACCTGACTGTCGGCGGTGCCGTCACTCAGTGCTACCGCGACATGGGAGCCCGCCACCGTGCCCGTGCCCACTCCATCCAGATCATTAAGGTGGACTCGATCCCTGCCGCC---AAGACCCGCCGCGTGCACGTGAAGCAGTTCCACGATTCAAAGATCAAGTTCCCTCTGGTCCAGCGT---------GTCCACCACAAGGGCAACAGGAAACTGTTCTCGTTCAGGAAGCCCAGGACCTACTTC
O76968_PODCA/4-174 GAGCTGAAGGAGTACAAGATCATTGGGAGACGTTTACCATCAGAAAAAACTCCCAATACACCACTATATCGTATGAGGATATTTGCACCAGATGTTGTTTCGGCAAAATCAAGATTTTGGTATTACATGAAGAAGTTGAAGAAATTGAAAAAAACTGTTGGAGAAGTAGTAATGTGCTCCGAGGTGTTTGACAAAAGCCCTACAACAGTGAAAAATTTTGGTGTCTGGATTCGATACAACTCTCGAAGTGGTACACATAACATGTACCGTGAATACAGAGATGTTACTGTGACTGGTGCCGTGACTCAATGTTATACTGATATGGCTGCTAGACATCGTGCTCGTGCAAGTTCTGTTCAAATTTTGAAAGTTGAAGAGGTGCCATCAAAT---AAATGCAGACGTCCTCATGTAAAACAAATGCATAACTCCAAGATGCGATTTCCAATGACTCACAGA---------GTGATGCGATCACAATTCAGATCCACATTCCAAGCCAAACGTCCTCATACTTTCTTG
RL18A_ARATH/5-178 AGGTTTCACCAGTACCAGGTTGTGGGAAGAGCTCTCCCGACAGAGAAGGATGTGCAGCCTAAGATTTACAGGATGAAGCTCTGGGCTACGAACGAGGTTCGTGCCAAGTCCAAGTTCTGGTATTTCTTGAGGAAGCTCAAGAAGGTGAAGAAGAGTAATGGACAGATGCTCGCCATCAACGAGATCTATGAGAAGAACCCAACAACGATCAAGAACTTCGGTATTTGGTTGAGGTACCAGAGTAGAACTGGGTACCACAACATGTACAAGGAGTACCGTGACACCACTCTTAACGGAGCTGTTGAGCAGATGTACACTGAGATGGCATCCCGTCACCGTGTCAGATTCCCTTGCATTCAGATCATCAAGACAGCCACTGTCCCAGCCAAG---CTGTGCAAGAGAGAGAGCACTAAACAGTTCCACAACAGCAAGATCAAGTTCCCATTGGTGTTCCGCAAGGTTAGACCACCAAGCAGGAAGCTGAAGACGACTTACAAGGCCAACAAGCCCAACTTGTTCATG