EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01721 alignment
(8 sequences with 108 bp)


SAKP_LACSK/19-54 AAATATTATGGTAACGGTGTACACTGTGGAAAACATTCATGTACCGTAGACTGGGGAACAGCTATTGGAAATATCGGAAATAATGCAGCTGCAAACTGGGCCACAGGC
PPA1_PEDAC/19-54 AAATACTACGGTAATGGGGTTACTTGTGGCAAACATTCCTGCTCTGTTGACTGGGGTAAGGCTACCACTTGCATAATCAATAATGGAGCTATGGCATGGGCTACTGGT
Q47784_ENTFC/24-59 AAATATTATGGAAATGGAGTGTATTGCACTAAAAATAAATGTACGGTCGATTGGGCCAAGGCAACTACTTGTATTGCAGGAATGTCTATAGGTGGTTTTTTAGGTGGA
LCCA_LEUGE/25-60 AAGTATTATGGTAACGGAGTTCATTGCACAAAAAGTGGTTGTTCTGTAAACTGGGGAGAAGCCTTTTCAGCTGGAGTACATCGTTTAGCAAATGGTGGAAATGGTTTC
SAKA_LACSK/20-55 AGATCATATGGCAACGGTGTTTACTGTAATAATAAAAAATGTTGGGTAAATCGGGGTGAAGCAACGCAAAGTATTATTGGTGGTATGATTAGCGGCTGGGCTAGTGGT
O30434_ENTFC/30-65 CGTTCATATGGTAATGGTGTTTATTGTAATAATAGTAAATGCTGGGTTAACTGGGGAGAAGCTAAAGAGAATATTGCAGGAATCGTTATTAGTGGCTGGGCTTCTGGT
CBB1_CARPI/20-55 ATCTCTTATGGCAATGGTGTTTATTGTAACAAAGAGAAATGTTGGGTAAACAAGGCAGAAAACAAACAAGCTATTACTGGAATAGTTATCGGTGGATGGGCTTCTAGT
CBB2_CARPI/19-54 GTAAATTATGGTAATGGTGTTTCTTGCAGTAAAACAAAATGTTCAGTTAACTGGGGACAAGCCTTTCAAGAAAGATACACAGCTGGAATTAACTCATTTGTAAGTGGA