EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01700 alignment
(2 sequences with 2721 bp)


VP3_EHDV1/1-899 ATGGCAGATCCACCAGATGCAAATGTACCA---------------AAAACGAGTCCGTATCTCAAAGGAGATGAGTTATCAAGTGACAGTGGACCTTTACTTTCAATCTTCGCTTTACAAGAGATTATGCAAAAGGTGCGACAAGCGCAATCAGAATATGTTGCAGCAACTAAAGACGTCGATTTAACGGTACCGGATGTTCAAAAAATAATCGATGGAGTTAAAGAGCTGGCCTCAGAGACAATCTATAAAATTGTACAGAAACCCATCATTTCATATAGGCATGTGGTGATGCAATCAAGGGATAGATTTCTCCGGGTGGACACTTATTATGAAAGGATGTCTGAAGTTGGCGATAAGATAGATGAAAATGAACCCGCGAAATTTTATGAAACTGTAATCAAAAAAGTAAGGCATTTACGTACCGAGGGAGCCTTTATCTTGCATAACATACCCACAAAAGATCATAGAGGCATGGAAATAGCGGATCCTGAGATCCTGGGCGTCGATGTCAAAAGCATATTACCGGTGCTAACGGCTGAGCATAGAGCGATGATACAGCATGTTCTAGATGGCGCTATAATAGAGAACGGTAATATAGCGACCCGTGATGTCGATGTGTATTTGGGTGCTTGTTCGGAATCAGTATATCGCATATACAATCGGTTACAAGGATATATCGAGGCCGTTCAATTGGAAGAATTGCGTCGCACGGTGACGTGGCTTGAGCGCCTGGGGAAACGAAAACGCATGACTTTTTCACAAGAATTTCTAACAGATTTTAGACGTGTAGATACAATTTGGGTACTGGCGTTGAGGCTGCCAGCCAACCCACGCGTGATTTGGGATGTACCGAGGTGTTCAATTGCAAATTTGATAATGAATATAGCGACGTGCTTACCGACAGGAGATATGTTTCGCCCCAATCCTCGCATAGCTTCAATCACGTTGACGCAAAGAATTACTACAACTGGACCATTTGCTATATTAACGGGATCAACGCCAACGGCACAACAATTAGATGACGTAAGAAAGATATATTTGGCGTTGATGTTTCCAGGACAAATAATTTTAGATTTAAAAATAGATCCGGGTGAAAGAATGGACCCAGCTGTACGGATGGTGGCAGGAGTCGTTGGGCATTTAATGTTTACGGCAGGCCCACGATTTACGAACATAACTCAAAATATGGCAAGGCAGCTAGATATCGCGCTGGCCGATTTTTTATTATATATGTATAATACCAGAATCCAAGTTCAGTATGGACCGACTGGAGAACCTTTAGATTTTAGAATCGGT------CGTGGACAGTATGATTGCAACGTATTTCGCGCCAACTTTCAAACGGGTACGGGATATAATGGATGGGGTTTAGTTGATGTTGAAAACAGGGAGCCAGCGCCTTATGATCATGCACAACGGTATATACGATATTGTAATATAGATTCACGAGAGCTAATACATCCAGCCACATTTGGTATTGGTATGAATTACCATTGTTATAATGAAATGTTGAGGATGTTAGTTGCTGCGGGTAAGGATACAGAAGCTGCGTTTTTCCGGAATATGTTACCGTTTCACATGGTCCGATTCGCTCGTATAAATCAGGTAATAAATGAAGATTTACACTCAGCTTTTTCGATGCCAGACGATCAGTTTAACGTGTTATTGGCGAATATGGTGGTAGGCCAGCAAGAAAGAGTTGACCCGGTGATATTGGACATAAGTTGGATCTCAATTTGGTACGCTTTCAATAGATCTTTTGAGCCGATCCGTCGAAACGAGATGCTAGAAAGTGCGCCGCTAATCGAATCGGTCTATGCCTCAGAATTGACAGTTATGAAGACAGATATGCAGCAGATGGCCCTATTACAGCGCCGTTTCCCAGATGTTTTAATTGAAGCTCGTCCCACACATTTCTGGAAAGCAGTTATGGAAGTATCACCAGAGCCTGTACGAGCGATCATGGATTTAGCGCATTCACATAGCTTTATCAATATCCGAGATATGATGAGGTGGATAGGTTTGCCTTCAATGCAGAATTCTATGAAGTTGGTGCTAGAAGAAGAAGCTTGGGCGGTGGCTAATGATTTCGAAGAATTAATGCTGACTGATCAGGTGTATATGTACCGTGATATGCTCCCGGAACCAAGGTTAGATGATATAGAAAGATTCAGGCAAGAAGGATTCTACTACACTAATATGTTGGATGGACCACCTGCGATCGATCGAGTGGTTCAATATACGTATGAGGTGGCAAGATTCGAGGCAAATATGGGACAACTACGAGCGGCGTTACGGAGAATTATGGATGATGAAAGATGGGTTAGATTCGGAGGTGTACTACGAACTGTACGGATTAAATTCTTCGATTCACGCCCGCCCGAAGAAATCCTCCAAGCATTACCTTTTGACTACCAGACAAATGAGAAGGGCGGA---TTGACTTATGCCACAATCAAATATGCGAATGATACCACAATATATTATTTAATCTATAATGTTGAGTATTCAAATTTACCTGATTCCTTGGTTTTAATCAATCCTACTTATGTGATGACCAAAGTATTTATGAATAAACGAATAGTAGAGAGGGTTCGAGTGGGACAAGCGTTGGCCGTAATGAATAAAAGATTTATAGCATTTAAAGGAAAGATGCGAATTATGGATATAAGCCAAGCGCTCAAGGTGGGCACCAAGCTAGCGGCGCCGACCGTA
VP3_BTV10/1-901 ATGGCTGCTCAGAATGAGCAACGTCCGGAACGAATA---------AAAACGACGCCGTATTTAGAAGGAGATGTGCTTTCGAGTGACTCAGGGCCACTGCTTTCTGTGTTCGCGTTACAAGAGATAATGCAAAAGGTGAGGCAAGTGCAAGCTGACTATATGACGGCAACACGAGAGGTTGATTTTACAGTACCGGATGTACAAAAGATTCTTGATGACATTAAAACGTTAGCTGCAGAACAAGTGTACAAAATCGTTAAAGTTCCTAGTATTTCATTCAGACATATCGTAATGCAGTCAAGAGATCGAGTTTTACGAGTGGATACCTACTATGAAGAGATGTCACAGGTTGGAGATGTTATAACGGAAGATGAACCAGAAAAATTCTATTCAACTATAATCAAGAAAGTGCGGTTCATACGCGGAAAAGGATCCTTTATATTACATGATATTCCGACCAGAGATCACCGCGGTATGGAGGTTGCTGAACCAGAGGTGTTAGGAGTTGAATTCAAGAATGTACTACCTGTGTTGACTGCCGAGCATCGCGCAATGATTCAGAACGCATTGGATGGATCGATAATCGAGAACGGAAACGTAGCTACACGAGACGTCGACGTATTCATAGGCGCTTGTTCGGAACCAATCTATCGTATATATAATAGATTGCAAGGGTATATTGAAGCGGTGCAGTTACAAGAGTTAAGGAACTCAATTGGGTGGTTAGAAAGGTTAGGGCAGAGGAAAAGAATCACGTATTCGCAAGAGGTTCTGACTGATTTTAGGAGGCAGGATACAATTTGGGTTTTAGCCTTACAGCTACCGGTTAATCCGCAGGTAGTGTGGGATGTGCCGCGCAGCTCTATCGCCAACTTAATCATGAATATAGCAACGTGCTTACCCACGGGGGAATACATCGCGCCAAACCCAAGAATTTCATCGATTACGCTGACCCAGAGAATAACGACAACTGGGCCATTTGCTATTCTAACAGGATCAACTCCAACCGCACAGCAACTTAATGATGTTAGGAAGATCTATTTAGCGCTAATGTTTCCTGGACAGATTGTACTTGATCTAAAAATTGATCCTGGTGAGAGGATGGATCCGGCAGTAAGAATGGTCGCTGGCGTTGTAGGTCATTTGCTCTTTACAGCAGGTGGAAGATTCACGAATTTAACACAAAATATGGCGAGACAGCTTGATATAGCCTTAAACGATTATTTACTTTATATGTATAACACCAGAGTTCAAGTCAATTATGGTCCAACAGGTGAGCCGTTAGATTTCCAGATTGGA------AGAAATCAGTATGACTGTAATGTTTTCAGAGCAGATTTTGCGACAGGAACGGGATACAATGGATGGGCTACGATAGATGTTGAGTATAGAGATCCGGCCCCTTACGTGCATGCGCAGCGCTACATACGTTATTGTGGTATCGATTCGCGTGAGTTAATTAATCCGACAACATATGGCATTGGGATGACTTATCATTGCTACAATGAGATGTTACGAATGCTGGTTGCTGCAGGGAGAGACTCTGAGGCGGCGTACTTTCGCAGCATGCTACCCTTTCACATGGTGAGGTTTGCTAGGATAAACCAAATCATAAACGAAGATTTACACTCCGTGTTTTCGTTGCCAGATGATATGTTCAACGCATTATTACCCGACCTAATTGCTGGGGCGCATCAGAACGCCGACCCAGTTGTGTTAGATGTGAGTTGGATATCACTGTGGTTTGCTTTCAACAGATCGTTTGAACCAACGCATAGGAATGAGATGCTTGAAATCGCCCCACTGATCGAGTCCGTTTATGCGTCGGAACTTTCAGTGATGAAGGTCGATATGCGACACTTGTCATTGATGCAGAGAAGATTTCCAGATGTTTTAATCCAAGCGAGGCCGTCCCATTTCTGGAAAGCGGTTCTGAATGATAGCCCGGAGGCGGTGAAAGCAGTCATGAACTTGTCGCATTCGCATAATTTCATCAATATAAGGGATATGATGCGTTGGGTACTGCTCCCATCACTACAACCATCGTTAAAGCTCGTATTAGAAGAGGAGGCATGGGCCGCTGCAAACGATTTCGAGGATCTGATGCTTACTGATCAAGTTTATATGCATCGAGATATGTTGCCAGAACCGCGGTTGGATGATATTGAGAGGTTCAGACAGGAAGGTTTCTATTACACGAATATGTTAGAAGCCCCACCAGAAATAGATCGTGTAGTTCAGTACACTTATGAGATTGCACGTTTACAAGCGAACATGGGCCAGTTTCGAGCGGCTTTAAGGCGCATTATGGATGATGACGACTGGGTGAGGTTTGGCGGTGTTTTACGCACTGTACGCGTTAAATTCTTTGATGCGCGACCCCCAGACGACATTCTACAAGGCTTACCTTTCAGCTATGATACAAATGAGAAAGGTGGA---TTATCATATGCGACAATTAAGTATGCTACTGAGACCACAATTTTCTATCTGATATATAATGTCGAATTCTCGAACACGCCTGATTCTTTGGTGTTGATTAATCCAACATACACGATGACTAAAGTTTTCATTAACAAGAGAATTGTTGAGCGGGTACGGGTCGGACAGATTCTGGCCGTATTGAACAGAAGATTTGTGGCATACAAAGGAAAAATGAGAATCATGGACATCACCCAATCGCTCAAGATGGGCACCAAGCTGGCTGCGCCAACTGTG