EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01364 alignment
(2 sequences with 1116 bp)


O07442_PORGI/231-598 TATACAGATCATGGCGACTTGTATAATACGCCGGTTCGTATGCTTGTTGTTGCAGGTGCAAAATTCAAAGAAGCTCTCAAGCCTTGGCTCACTTGGAAGGCTCAAAAGGGCTTCTATCTGGATGTGCATTACACAGACGAAGCTGAAGTAGGAACGACAAACGCCTCTATCAAGGCATTTATTCACAAGAAATACAATGATGGATTGGCAGCTAGTGCTGCTCCGGTCTTCTTGGCTTTGGTTGGTGACACTGACGTTATTAGCGGAGAAAAAGGAAAGAAAACAAAAAAAGTTACCGACTTGTATTACAGTGCAGTCGATGGC---GACTATTTCCCTGAAATGTATACTTTCCGTATGTCTGCTTCTTCCCCAGAAGAACTGACGAACATCATTGATAAGGTATTGATGTATGAAAAGGCTACTATGCCAGATAAGAGTTATTTGGAGAAAGTTCTCTTGATTGCAGGTGCAGATTATAGCTGGAATTCCCAGGTAGGTCAGCCAACCATTAAATACGGT---ATGCAGTACTACTACAACCAAGAGCATGGTTATACCGACGTGTACAACTATCTCAAAGCCCCTTATACA------GGTTGCTACAGTCATTTGAATACCGGAGTCAGCTTTGCAAACTATACAGCGCATGGATCTGAGACCGCATGGGCTGATCCACTTCTGACTACTTCTCAACTGAAAGCACTCACTAATAAGGACAAATACTTCTTAGCTATTGGCAACTGCTGTATTACAGCTCAATTCGATTATGTACAGCCTTGCTTCGGAGAGGTAATAACTCGCGTTAAGGAGAAAGGGGCTTATGCCTATATCGGTTCATCTCCAAATTCTTATTGGGGCGAGGACTACTATTGGAGTGTGGGTGCTAATGCCGTATTTGGTGTTCAGCCTACTTTTGAAGGTACGTCTATGGGTTCTTATGATGCTACATTCTTGGAGGATTCGTACAACACAGTGAATTCTATTATGTGGGCAGGTAATCTTGCCGCTACTCATGCTGGAAATATCGGCAATATTACCCATATTGGTGCTCATTACTATTGGGAAGCTTATCATGTCCTTGGCGATGGTTCGGTTATGCCTTATCGTGCA
CPG1_PORGI/228-576 TACACACCGGTAGAGGAAAAACAAAATGGT------CGTATGATCGTCATCGTAGCCAAAAAGTATGAGGGAGATATTAAAGATTTCGTTGATTGGAAAAACCAACGCGGTCTCCGTACCGAGGTGAAAGTGGCAGAAGATATTGCTTCTCCCGTTACAGCTAATGCTATTCAGCAGTTCGTTAAGCAAGAATACGAGAAA---------GAAGGTAATGATTTGACCTATGTTCTTTTGGTTGGCGATCACAAAGATATTCCTGCCAAAATTACTCCGGGGATCAAA------TCCGACCAGGTATATGGACAAATAGTAGGTAATGACCACTACAACGAAGTCTTCATCGGTCGTTTCTCATGTGAGAGCAAAGAGGATCTGAAGACACAAATCGATCGGACTATTCACTATGAGCGCAATATAACCACGGAAGACAAATGGCTCGGTCAGGCTCTTTGTATTGCTTCGGCTGAAGGAGGCCCATCCGCAGACAATGGTGAAAGTGATATCCAGCATGAGAATGTAATCGCCAATCTGCTTACCCAGTATGGCTATACCAAGATTATCAAATGTTATGATCCGGGAGTAACTCCTAAAAACATTATTGATGCTTTCAACGGAGGAATCTCGTTGGTCAACTATACGGGCCACGGTAGCGAAACAGCTTGGGGTACGTCTCACTTCGGCACCACTCATGTGAAGCAGCTTACCAACAGCAACCAGCTACCGTTTATTTTCGACGTAGCTTGTGTGAATGGCGATTTCCTATTCAGCATGCCTTGCTTCGCAGAAGCCCTGATGCGTGCACAAAAAGATGGTAAG------CCGACAGGTACTGTTGCTATCATAGCGTCTACGATCAACCAGTCTTGGGCTTCT---------------------------CCTATGCGCGGGCAGGATGAGATGAAC---------GAAATTCTGTGCGAAAAACACCCGAACAACATCAAG---CGTACTTTCGGTGGTGTCACCATGAACGGTATGTTTGCTATGGTGGAAAAGTATAAAAAGGATGGTGAG---AAGATGCTCGACACATGGACTGTTTTCGGCGACCCCTCGCTGCTCGTTCGTACACTT