EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01250 alignment
(12 sequences with 276 bp)


RS6_THETH/2-93 CGCAGGTACGAGGTGAACATCGTCCTGAACCCCAACCTGGACCAGAGCCAGCTCGCCCTGGAGAAGGAGATCATCCAGCGGGCTCTGGAGAACTACGGCGCCCGCGTGGAGAAGGTGGAGGAGCTGGGGCTTCGCCGCCTGGCCTACCCCATCGCCAAGGACCCCCAGGGCTACTTCCTCTGGTACCAGGTGGAGATGCCCGAGGACCGGGTGAACGACCTGGCCCGGGAGCTCCGCATCCGGGACAACGTGCGCCGGGTCATGGTGGTGAAGTCC
RS6_MYCLE/2-93 CGTCCATACGAAATCATGGTCATTCTTGACCCCACGCTCGACGAGTGCACTGTCGGTCCGTCTTTGGAGACGTTCCTCAACGTCGTCCGCAAGGACGGTGGAGCTATCGATAAGGTCGACATCTGGGGTCGGCGCCGGCTGGCCTACGAGATCTCCAAGCACGCTGAAGGCATCTACGTTGTCATTGATCTGAAGGCTGCGCCGGCAACGGTATCCGAGCTTGACCGCCAGCTCAGCCTCAACGAGTCGGTGTTGCGCACCAAGGTAATGCGCACT
RS6_HELPY/2-93 AGGCATTATGAAACGATGTTTATTCTCAAACCTACTTTAGTAGAAGAAGAGATTAAATCCAAGATTGAGTTTTATAAAGAAGTGATCACTAAGCATCACGGCGTGATTGAAACGAGCCTGGATATGGGCATGCGTAATTTAGCTTATGAAATCAAAAAGCACAAAAGAGGCTATTATTATGTGGCGTATTTCAAAGCGGAGCCGTCAATGATTGTAGAGCTTGAACGATTGTATCGCATCAATGAAGACGTGTTGCGTTTCATTGTGATCAAATAC
RS6_BACSU/2-93 AGAAAGTACGAAGTTATGTACATTATCCGCCCAAACATTGACGAAGAGTCTAAAAAAGCAGTTATCGAGCGTTTCAACAACGTTCTGACTTCTAACGGTGCGGAGATCACTGGAACAAAGGATTGGGGTAAACGTCGTCTTGCTTACGAAATCAACGATTTCCGCGACGGTTTCTACCAAATCGTAAACGTTCAATCTGACGCTGCGGCAGTTCAAGAATTTGACCGTCTAGCTAAGATCAGTGACGATATCATTCGCCACATTGTTGTTAAAGAA
RS6_HAEIN/2-92 CGTCACTACGAAATCGTGTTTATGGTTCATCCG---GACCAAAGCGAGCAAGTACCAGGTATGATCGAACGTTACACCGGTTCTGTAAAAGAAGCTGGTGGTCAAGTTCATCGCCTAGAAGATTGGGGTCGTCGCCAATTAGCGTACCCAATTAATAAATTACACAAAGCACATTATGTGCTTATGAATGTAGAAGCGCCTCAACAAGTCATCGACGAGCTAGAAACGACTTTCCGTTATAACGATGCTGTATTACGCAGTCTTGTTATCCATACT
RS6_ECOLI/2-92 CGTCATTACGAAATCGTTTTTATGGTCCATCCT---GATCAGAGCGAACAGGTTCCGGGCATGATCGAGCGCTACACTGCTGCCATCACTGGTGCAGAAGGCAAGATCCACCGTCTGGAAGACTGGGGCCGCCGTCAGCTGGCTTACCCGATCAACAAACTGCACAAAGCACACTACGTTTTGATGAATGTTGAAGCTCCGCAGGAAGTGATCGATGAGCTGGAAACTACCTTCCGCTTCAACGATGCCGTTATCCGCAGCATGGTTATGCGTACC
RS6_SYNY3/4-95 AATAGTTACGAACTGATGGTAATTCTCCGTCCCGACCTGAATGAAGAACGGGTTAGCCAAGAAGTTACCAAATACCAAGAATTTTTGACCAACAATGCCGCCGAAGAAGTATCGGTGAAGGTTTGGGGTAAACGCCGTCTAGCTTACCAAATCCGTCGCTTTAACGATGGCATTTATGTTTTGTTCAACTTCAACGGTGAAGGCCAGCAGATTGCTTTAATTGAACGGGATATGCGTCTTAACGATAATGTGATGCGCTTTTTGAGCATTAAGCTC
RR6_CYAPA/13-104 ATAACTTATCGTACTACTTATATTCTTAAACCAAGTTTAACTGAAGAAGAAATTACTAAAGAAATTGAAGATTATCAAAAATTATTAATTGATAATGGTGCTGAAGATATTATTATTGAAAATACTGGTAAATGTAGATTAGCCTATTTAATAAACAAACAAAATGATGGTATCTACTTTCAAATAACATATCGTGGTGCAAATACACTAGTAAATATTTTACAACGTCGAATGCGCTTAAGTATTAATACTTTACGTTATCAAACTTTTAAAGTA
RR6_PORPU/13-104 AATTGGTATGAAACTGTTTATTTAATAAAATCCGATTTGAACGAAGACAGGACTCTATGTATAATAAATGAATACAAAAGTATGCTAACCAATGGTGGAGCTAAAAATATCATTCTACAACATAGAGGTAGAAGACATCTGAGTTATTCTATTAAAGATTATAGAGATGGTATTTATGTACAAGTCAATTATGAAGGAAATGGGAAACTTGTTCAATCTTTTGAAAAGTCGTTAAGATTTGATGAAAATATTATTAGGTATTTAACAAATAAGCAG
RS6_MYCPN/1-90 ATGCAATACAACATTATTCTTTTAGTTGATGGTTCGCTCTCGTTAGAGCAAGCTAACCAAGTGAATGAAAAACAACAGCAAACGTTAACCAACGTTGAGGGTTTGCAAACA------GAATACCTTGGTTTAAAGGAGTTGGCATACCCAATTAAGAAACAACTCTCAGCGCATTATTACCGCTGGAAGTTTAGTGGTGATAACCAATCCACGAAGGACTTTAAGCGTACCGCTAACATTAACAAGCAAGTATTACGTGAACTGATTATTAACTTA
RS6_MYCGE/1-90 ATGCACTACAATATCATTCTTTTAGTTGATGGTACGCTTAGTTTAGAACAAGCTAACCAAGTTGAACAAAAACACCAAAAATTGCTTGAAAAGGCAACTGAATTTAAAAGT------GAATACTTAGGTTTAAAAGAGTTGGCTTACCCCATTAAAAAGCAACTTTCTGCTCACTATTACAGATGGAGTTTTCATGGTGAAAGCAATTGTACTAAGGAGTTTAAAAGAGCTGCTAACATCAATAAGCAGATAATAAGAGAGTTAATTATTAACAGA
RR6_ODOSI/5-96 AAAAAATATGAAATGATGATTCTTTTAACTGAAGAATTTAATGATAGCGAATTAAAGACTTGGGCATTTAATTATGCAAAAGCTTTAAGAAAATTAAGTGCTTCAGAAATATCTGTAATTTCTCGTGGAAAACGTGATTTATCGTATTATATTAATAACCAAAAAAAAGGAAACTTTATTCAAATAAATTTTTCAAGCATGCCTAAATATGTCGATAATTTTTCAAAAAATTTAAAATTTGATTCCAATGTTTTAAGATTTTTGATTTTAAATAAA