EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01231 alignment
(4 sequences with 1290 bp)


YJ48_YEAST/19-446 CCACTACCAGTGCTAGAAAAATACTGTATCTCGCCACATCATGGGTTTTTGGACGACCGGTTACCCTTGACCAGACTGAGCAGCAAGAAATATATGAAATGGGAAGAAATCGTTGCTGACCTGCCCTCTCTTTTGCAAGAGGATAACAAGGTGCGGAGCGTCATCGATGGGCTGGATGTCTTGGACTTGGATGAGACGATCTTGGGCGACGTCAGGGAGCTCAGAAGAGCATATTCCATTTTGGGGTTTATGGCGCACGCTTATATTTGGGCCAGCGGAACTCCC------CGGGATGTATTACCGGAGTGTATTGCAAGGCCACTGTTGGAGACAGCACATATTTTGGGTGTGCCACCGTTAGCTACGTACTCCTCGTTGGTGTTATGGAACTTCAAAGTGACCGACGAGTGCAAGAAAACGGAAACCGGGTGTTTGGACTTGGAAAATATTACAACGATAAACACATTTACGGGAACCGTTGACGAAAGTTGGTTTTATCTGGTCAGCGTGCGGTTTGAAAAAATCGGCAGCGCTTGTTTAAACCATGGGTTGCAGATATTGAGAGCCATTAGAAGCGGTGATAAAGGAGACGCTAACGTGATAGACGGGTTGGAGGGCTTGGCTGCAACGATCGAAAGGTTATCGAAAGCCTTGATGGAAATGGAGCTTAAGTGTGAACCCAATGTATTTTATTTCAAGATAAGACCATTTTTGGCCGGGTGGACGAATATGTCGCATATGGGGTTACCACAGGGTGTTAGGTATGGAGCGGAAGGACAGTATCGGATCTTTTCTGGCGGGTCCAATGCGCAAAGCTCGTTGATACAGACACTGGACATCCTTTTGGGTGTGAAACACACTGCGAATGCTGCGCATTCTTCCCAAGGAGACAGCAAGATCAATTATCTGGACGAAATGAAAAAATACATGCCAAGAGAACATCGTGAATTTCTTTACCATTTGGAATCGGTATGTAATATTCGCGAATACGTTTCTCGTAACGCTTCTAACCGTGCATTGCAAGAGGCCTATGGACGTTGCATTTCCATGCTGAAAATATTTAGAGATAACCACATTCAAATTGTTACCAAGTACATTATTTTGCCCTCCAATTCAAAGCAACACGGCTCCAATAAGCCGAACGTACTAAGTCCAATCGAGCCCAATACCAAAGCAAGTGGTTGTTTAGGGCATAAAGTTGCCTCATCTAAGACTATCGGAACCGGTGGTACAAGATTAATGCCCTTCTTAAAGCAGTGCAGGGACGAGACTGTCGCCACTGCGGAC
MYG_NORMA/1-377 GCAGACATTCAGCTGAGCAAGTACCATGTGTCTAAGGACATCGGATTTCTCCTGGAA------CCTCTTCAGGATGTGCTGCCTGACTATTTCGAGCCCTGGAATCGCCTGGCGAAGTCTTTGCCAGAACTTGTAGCC---AGTCACAAGTTCAGAGATGCGGTGAAAGAGATGCCTTTGTTGGATCAGTCCAAG------TTGGCCGGGTACCGTCAGAAGCGGTTGGCCCACTTGCAGCTGGTTCTCATTACATCCGGGTACCTGTGGCAGGAGGGGGAGGGTGGAGCAGTGCAGCGGCTCCCTGAATGTGTTTCCAAGCCATTGTGGAACGTGTCCAACGACCTGGGCTTAAAGCCTGTCCTGACTTTTGCTGACATTTGTCTGACTAACTGCAAGGTGAAG---------------------AACGGT---------------GACATCGAGGTCATGTACAATCTCCCCGGGGGAGCCGGCACTGAGTGGTTCTTGAAGGTCTGCGGACTCGTGGAACTTGCTTTTGGAAAAAGTGGTCAGGCAATTCAGAATGTACTGGATGGTGCTAAGGCTAACGACAAG------GCCAAGATGGCATCCGGCTTTACTGACTTGACGGCTGCAATTGGCAACATGCAGACTGCCTTGGCAAGGATGAACGAAAATTTGACGCCTGAGCATTTCTACAACGGTGTGCGGCCATTCCTTAACGGGTTTGGGGGACCAGCCAGTCCTATCAGTGGTGGACTTGTATATGAAGGTGTATCAGACAAGCCAGTGACGATGATCGGCGGCAGTGCAGCTCAGAGCAGTACCATGCAGGTCCTTGACGGCCTCCTGGGCATAACACATTCCCCAGAAAAG---CAG------------------------GCCTTCTTGGACGAAATCAGGAACTACATGCCTCCCTCCCACAAACAAATGCTGGCTGATTTGACGAATATGCCGCGCAAGGTACCTCAAGTTGTGGCAGAAACCAAGGATGCCAATCTCACCAAAGCATTCAACGGCTGCGTTGCCGCTTTCGTCCAGTACCGTAGTTATCACATACAGGTCGTAACAAAGTACATCGTGACAGCATCA------------------------AAG------------TCAGACTCTCCCAAGAGTCTCGCTTATAAG---------------------------------------GACACCGGTAAATCAGATCTCATCCCTTTCCTGAAGGAAGTGCGGGATGACACGGAGAAGGTGCAGCAG
I23O_MOUSE/12-404 TCTAGAAGGATCCTTGAAGACCACCACATAGATGAAGATGTGGGCTTTGCTCTACCA------CATCCACTGGTGGAGCTGCCCGACGCATACAGCCCCTGGGTCCTTGTGGCTAGAAATCTGCCTGTGCTGATTGAG---AACGGGCAGCTTCGAGAAGAAGTTGAAAAGCTGCCCACACTGAGCACGGACGGA------CTGAGAGGACACAGGTTACAGCGCCTGGCACACCTGGCCCTGGGGTACATCACCATGGCGTATGTGTGGAACCGAGGGGATGACGATGTTCGAAAGGTGCTGCCCCGCAATATTGCTGTTCCCTACTGCGAGCTCTCAGAGAAGTTGGGCCTGCCTCCTATTCTGTCTTATGCAGACTGTGTCCTGGCAAACTGGAAGAAAAAGGACCCC---------------AATGGGCCCATGACATACGAGAACATGGACATTCTGTTCTCATTTCCTGGTGGGGACTGCGACAAGGGCTTCTTCCTCGTCTCTCTATTGGTGGAAATCGCAGCTTCTCCTGCAATCAAAGCAATCCCCACTGTATCCAGTGCAGTAGAGCGTCAAGACCTG------AAAGCATTGGAAAAGGCACTGCACGACATAGCTACCAGTCTGGAGAAAGCCAAGGAAATTTTTAAGAGGATGCGTGACTTTGTGGACCCAGACACGTTTTTCCACGTTCTCCGCATATATCTGTCTGGCTGGAAATGC---AGCTCCAAGCTGCCAGAAGGTCTGCTGTATGAGGGGGTCTGGGACACCCCAAAAATGTTTTCAGGGGGCAGTGCAGGCCAGAGCAGCATCTTCCAGAGTCTTGATGTCCTTCTGGGAATAAAACACGAGGCTGGCAAAGAATCTCCTGCA------------------GAATTCCTCCAGGAAATGAGAGAGTACATGCCTCCAGCCCACCGGAACTTCCTTTTCTTCTTAGAGTCAGCTCCC---CCAGTCCGTGAGTTTGTCATTTCAAGACACAATGAAGACTTGACGAAAGCTTATAACGAGTGTGTGAATGGTCTGGTCTCTGTGAGAAAGTTCCACCTCGCAATAGTAGATACTTACATTATGAAACCTTCGAAGAAGAAG------------CCCACTGATGGCGACAAGTCGGAAGAGCCCTCAAATGTGGAAAGCAGA---------------------------------------GGGACTGGGGGTACGAATCCCATGACTTTCCTAAGGAGTGTGAAAGATACAACCGAGAAAGCTCTTCTG
I23O_HUMAN/8-400 TCCTGGACAATCAGTAAAGAGTACCATATTGATGAAGAAGTGGGCTTTGCTCTGCCA------AATCCACAGGAAAATCTACCTGATTTTTATAATGACTGGATGTTCATTGCTAAACATCTGCCTGATCTCATAGAG---TCTGGCCAGCTTCGAGAAAGAGTTGAGAAGTTAAACATGCTCAGCATTGATCAT------CTCACAGACCACAAGTCACAGCGCCTTGCACGTCTAGTTCTGGGATGCATCACCATGGCATATGTGTGGGGCAAAGGTCATGGAGATGTCCGTAAGGTCTTGCCAAGAAATATTGCTGTTCCTTACTGCCAACTCTCCAAGAAACTGGAACTGCCTCCTATTTTGGTTTATGCAGACTGTGTCTTGGCAAACTGGAAGAAAAAGGATCCT---------------AATAAGCCCCTGACTTATGAGAACATGGACGTTTTGTTCTCATTTCGTGATGGAGACTGCAGTAAAGGATTCTTCCTGGTCTCTCTATTGGTGGAAATAGCAGCTGCTTCTGCAATCAAAGTAATTCCTACTGTATTCAAGGCAATGCAAATGCAAGAACGG------GACACTTTGCTAAAGGCGCTGTTGGAAATAGCTTCTTGCTTGGAGAAAGCCCTTCAAGTGTTTCACCAAATCCACGATCATGTGAACCCAAAAGCATTTTTCAGTGTTCTTCGCATATATTTGTCTGGCTGGAAAGGC---AACCCCCAGCTATCAGACGGTCTGGTGTATGAAGGGTTCTGGGAAGACCCAAAGGAGTTTGCAGGGGGCAGTGCAGGCCAAAGCAGCGTCTTTCAGTGCTTTGACGTCCTGCTGGGCATCCAGCAGACTGCTGGTGGAGGACATGCTGCT------------------CAGTTCCTCCAGGACATGAGAAGATATATGCCACCAGCTCACAGGAACTTCCTGTGCTCATTAGAGTCAAATCCC---TCAGTCCGTGAGTTTGTCCTTTCAAAAGGTGATGCTGGCCTGCGGGAAGCTTATGACGCCTGTGTGAAAGCTCTGGTCTCCCTGAGGAGCTACCATCTGCAAATCGTGACTAAGTACATCCTGATTCCTGCAAGCCAGCAG------------CCAAAGGAGAATAAGACCTCTGAAGACCCTTCAAAACTGGAAGCCAAA---------------------------------------GGAACTGGAGGCACTGATTTAATGAATTTCCTGAAGACTGTAAGAAGTACAACTGAGAAATCCCTTTTG