EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01216 alignment
(3 sequences with 1158 bp)


CASQ1_RANES/2-384 AAGGGGCCGTGGCTGGTTCTGGCAGCTCTGTGCCTCTCCCTGGCC---------AACCTGGGACCCAGGGGCGAGGACGGGCTTGACTTTCCAGAGTACGACGGAGAGGACAGGGTCATCCACATCAGCCTGAAGAACTACAAGGCTGCCCTGAAGAAGTATGAAGTCTTGGCGTTGCTCTACCATGAACCTATTGGGGATGACAAAGCCTCCCAAAGGCAGTTCGAAATGGAAGAGCTCATTCTGGAGTTAGCTGCCCAAGTCCTAGAAGATAAAGGTGTGGGCTTTGGGTTGGTGGACTCTGAAGATGACGCTGCCGTAGCCAAGAAGCTAGGACTGGATGAAGAAGACAGTATCTACGTGTTTAAGGATGATGAAATGATTGAGTATGATGGAGAGTTCTCAGCCGACACCTTGGTGGAATTCTTACTTGACGTACTTGAGGACCCAGTAGAGTTTATTGATGGAAGCCATGAACTTGCTGCCTTTGAGAACCTTGACGACGAGCCCAAACTCATTGGATACTTCAAAAATGAAGATTCCGAACATTACAAGGCCTATGAAGATGCCGCTGAGGAGTTCCACCCATACATCCCATTCTTTGCCACATTTGATGCAAAGGTTGCCAAGACGTTGACCTTGAAGCTGAACGAGATTGACTACTACGAGCCCTTCCATGATGAGCCCATCACTATCCCCAGCAAGCCCAACAGCGAAAAGGAGATCGTGGACTTCCTGCACCAGCACAAGAGACCAACACTGAGGAAACTGCGGCCAGACAGCATGTATGAGACCTGGGAAGATGACTTGAATGGAATCCACATTGTTGCTTTTGCAGAGGAGGATGATCCTGATGGTTATGAGTTTTTGCAGATCATCAAGGAGGTTGCAGAGGACAATACCGATAACCCTGACCTAAGCATCATCTGGATTGACCCCGAGGACTTCCCACTGCTGATCCCCTACTGGGAAGAGAAGTTTGGCATCGACCTGTCTCGCCCTCATATCGGCGTGGTGAATGTGACTGATGCTGATAGTGTTTGGATGGACATGGATGATGAAGAGGACCTTCCTACAGTGGACGAACTGGAAGACTGGATTGAAGATGTTCTGGAGGGTGAAGTCAACACTGAAGATGATGACGATGATGACGATGAT
CASQ1_HUMAN/5-390 GCTGTGCCGGGTCTGCGGCTGGCACTGCTGTTGCTGCTGGTGCTAGGGACACCCAAGTCAGGGGTACAGGGGCAGGAAGGGCTGGACTTCCCTGAGTACGATGGTGTGGACCGTGTGATCAATGTCAATGCAAAGAACTACAAGAATGTGTTCAAGAAGTATGAGGTGCTGGCACTCCTCTACCATGAACCCCCCGAGGATGACAAGGCCTCACAAAGACAATTTGAGATGGAGGAGCTGATCCTGGAGTTAGCAGCCCAAGTCCTAGAAGACAAGGGTGTTGGCTTCGGGCTGGTAGACTCTGAGAAGGATGCAGCTGTGGCCAAGAAACTAGGCCTAACTGAAGTGGACAGCATGTATGTATTCAAGGGAGATGAAGTCATTGAGTACGATGGCGAGTTTTCTGCTGACACCATCGTGGAGTTTCTGCTTGATGTCCTAGAGGACCCTGTGGAATTGATTGAAGGTGAACGAGAGCTGCAGGCGTTTGAGAATATTGAGGATGAGATCAAACTCATTGGCTACTTCAAGAGCAAAGACTCAGAGCATTACAAAGCCTTCGAGGATGCAGCTGAGGAGTTTCATCCCTACATCCCCTTCTTCGCCACCTTCGACAGCAAGGTGGCAAAGAAGCTGACCCTGAAGCTGAATGAGATTGATTTCTACGAGGCCTTCATGGAAGAGCCTGTGACCATCCCAGACAAGCCCAATAGCGAAGAGGAGATTGTCAACTTCGTGGAGGAGCACAGGAGATCAACCCTGAGGAAACTGAAGCCGGAGAGTATGTATGAGACCTGGGAGGATGATATGGATGGAATCCACATTGTGGCCTTCGCAGAGGAAGCTGATCCTGATGGTTTCGAGTTCTTAGAGACTCTCAAGGCTGTGGCCCAAGATAACACTGAAAACCCAGATCTTAGCATCATCTGGATTGACCCTGATGACTTCCCCCTGCTGGTCCCATACTGGGAGAAGACGTTTGACATCGACTTGTCAGCCCCACAAATAGGAGTCGTCAATGTTACTGATGCGGATAGCGTATGGATGGAAATGGACGATGAGGAGGACCTGCCTTCTGCTGAGGAGCTGGAGGACTGGCTGGAGGATGTCCTGGAGGGCGAGATCAACACAGAGGACGATGACGATGATGATGATGAC
CASQ2_CANFA/2-381 AAGAGAACACACCTGTTCATCGCGGGGCTCTACCTGCTGGCCTCC------------------TGCCGGGCAGAAGAGGGGCTCAACTTCCCCACGTATGATGGCAAAGACCGTGTGGTCAGTCTCACTGAGAAGAACTTCAAGCAGGTTTTGAAGAAATACGACGTGCTTTGCCTCTACTACCACGAGTCCGTGTCTTCGGACAAAGTCGCGCAGAAACAGTTCCAGCTGAAGGAAATCGTGCTCGAGCTTGTCGCCCAGGTCCTGGAGCATAAAGATATAGGCTTTGTGATGGTGGATGCCAAGAAAGAAGCCAAGCTTGCCAAGAAGCTGGGTTTTGATGAAGAAGGAAGCCTGTATGTTCTTAAGGGTGATCGCACGATTGAGTTTGATGGCGAGTTTGCAGCTGACGTCTTGGTGGAATTTCTCCTGGATCTAATTGAAGATCCTGTGGAGATCATCAACAGCAAACTCGAAGTCCAAGCCTTTGAACGCATTGAGGACCAGATCAAACTCATTGGCTTTTTCAAGAGTGAGGAGTCAGAGTATTATAAGGCTTTTGAGGAGGCAGCTGAACACTTCCAACCTTACATCAAATTTTTTGCTACCTTTGACAAAGGGGTTGCAAAGAAATTGTCCTTGAAGATGAATGAGGTTGACTTCTATGAGCCATTTATGGATGAGCCCATTGCCATCCCTGACAAACCTTACACAGAAGAGGAGCTTGTGGAGTTTGTGAAGGAACACCAAAGACCCACCCTACGTCGCCTACGCCCAGAAGACATGTTTGAAACATGGGAAGATGATTTGAACGGCATCCACATTGTGGCCTTTGCAGAGAGGAGTGACCCAGATGGCTACGAGTTCCTGGAAATCCTGAAACAGGTGGCCCGAGACAATACAGACAACCCTGACCTGAGCATCGTGTGGATTGACCCGGATGACTTTCCTCTGCTTGTTGCCTACTGGGAAAAGACTTTCAAGATTGACCTATTCAAGCCACAGATCGGGGTGGTGAATGTGACAGATGCCGACAGTGTCTGGATGGAGATTCCTGATGATGATGACCTGCCCACAGCTGAGGAGCTGGAGGACTGGATCGAGGATGTGCTTTCTGGAAAGATAAACACTGAAGATGATGACAATGAAGAGGGGGAT