EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01214 alignment
(7 sequences with 624 bp)


STELL_DROME/11-172 TGGATCGATTGGTTCCTCGGGATCAAGGGCAACCAGTTCCTCTGCCGCGTGCCCACCGACTACGTGCAGGATACGTTCAACCAGATGGGCTTG---------GAG---TATTTCAGCGAGATACTGGACGTGATCCTGAAGCCGGTGATCGATAGT---------------------------------------------------------------------------------------------------------------TCCTCTGGCTTGTTGTACGGCGATGAAAAGAAGTGGTACGGCATGATTCACGCCCGATACATCAGGTCAGAGCGTGGCCTGATTGCTATGCACCGAAAATATTTGCGAGGAGATTTTGGATCGTGTCCCAATATCTCCTGTGATAGGCAGAACACCCTGCCAGTGGGCCTCAGCGCTGTATGGGGCAAGTCAACCGTCAAGATCCACTGCCCACGGTGTAAAAGCAACTTTCATCCGAAGTCT------GATACACAGCTGGACGGAGCGATGTTCGGGCCCAGCTTCCCGGACATCTTCTTCTCGCTGCTGCCGAACTTGACATCG---------CCCCTGGACGACCCACGTACC
CSK2C_YEAST/38-213 TGGATCGATTTATTTCTTGGGAGAAAAGGCCATGAATATTTCTGTGATGTCGATCCTGAGTACATCACTGATCGTTTTAATCTGATGAACTTGCAAAAGACAGTTTCAAAATTTTCCTACGTGGTACAATATATTGTGGATGATTTGGATGATAGTATCCTAGAGAATATGACACAT---------------------------------------------------------------------------------------GCCCGTTTAGAACAATTAGAATCAGATTCCCGGAAGCTGTATGGTCTCATCCATGCACGCTACATTATAACTATCAAAGGATTGCAAAAAATGTACGCTAAGTACAAAGAGGCGGACTTTGGAAGATGTCCCCGTGTGTATTGTAATTTACAACAGTTGTTACCGGTTGGTTTGCATGACATTCCTGGTATAGATTGTGTCAAGTTATATTGTCCATCTTGTGAGGATCTTTATATACCAAAATCATCGAGACATAGTTCCATTGATGGTGCATACTTTGGAACAAGTTTTCCAGGTATGTTTTTGCAAGCATTTCCAGATATGGTACCC---------AAACACCCAACTAAAAGATAT
CSK2B_CAEEL/9-182 TGGATCACATGGTTCTGTGGCCTTCGTGGAAATGAGTTTTTCTGTGAAGTCGACGAGGAATATATTCAGGATCGGTTCAATTTGACAGGTCTCAATGAGCAAGTGCCCAAGTATCGACAGGCTCTTGACATGATTCTTGACTTAGAACCAGATGAC---ATAGAG---GATAACGCA---------------------------------------------------------------------------------------ACGAACACTGATCTTGTTGAACAAGCCGCTGAAATGCTTTATGGACTCATTCACGCTAGATATATTCTTACGAATAGAGGAATCTCACAGATGGTCGAAAAGTGGCGTGATCATGACTTTGGAGTTTGCCCACGTGTCTACTGTGAAAATCAGCCAATGCTTCCAATTGGATTGTCTGATGTTCCTGGCGAGGCTATGGTGAAATTGTACTGTCCACGTTGCAATATGGTTTTTGTTCCACGATCATCACGTCATCAACATACTGATGGAAGCTATTTTGGCACCGGATTCCCACATATGCTCTTCTTTGTTCATCCTGATCTGCGTCCA---------CGCAGACCAGTCACTCAATTC
CSK2B_RAT/9-183 TGGATTTCCTGGTTCTGTGGGCTCCGTGGTAATGAATTCTTCTGTGAGGTGGATGAAGACTACATCCAGGACAAATTTAATCTTACTGGACTCAATGAGCAGGTGCCTCACTATCGACAAGCCCTAGACATGATCTTGGACCTGGAACCTGATGAAGAGCTGGAA---GACAACCCC---------------------------------------------------------------------------------------AACCAGAGTGACTTGATTGAGCAGGCGGCCGAGATGCTCTATGGGTTGATCCACGCCCGCTACATCCTCACCAACCGGGGCATTGCACAAATGTTGGAAAAGTACCAGCAAGGAGACTTTGGCTACTGTCCTCGAGTATACTGTGAGAACCAGCCGATGCTTCCCATCGGCCTTTCGGACATCCCAGGAGAGGCCATGGTGAAGCTCTACTGCCCCAAGTGCATGGACGTGTACACACCCAAGTCCTCTAGGCACCACCACACGGATGGCGCATACTTCGGCACTGGTTTCCCTCACATGCTCTTCATGGTGCATCCCGAGTACCGGCCC---------AAGCGGCCGGCCAACCAGTTT
CSK2B_SCHPO/16-187 TGGGTTGATTGGTTTTTAGGACTAAAAGGAAACGAATTTTTTTGCGAAGTCGACGAAGACTTCATCCAGGATCGCTTTAATTTGACTGGATTGAGTCATGAAGTTCCACACTACTCCCAGTCTTTAGACCTCATTTTAGATGTATTGGATCCTGAT------------TTACCAGAG---------------------------------------------------------------------------------------GAAGTACAAGATGAGGTAGAAGCTAGTGCTCGTCATTTGTACGGCCTTATTCACGCCCGTTATATCTTAACGGCTCAGGGTTTATATAAAATGCTTGAGAAATACAAAAAATGTGACTTTGGGCATTGCCCTAGAGTTTTATGCAACGGACAGCCAATGTTGCCCGTCGGCTTGTCGGATATTGCCCATACAAAATCCGTTAAATTATACTGTCCTCGGTGTGAGGATGTGTACACACCAAAATCACAAAGACATGCATCCATTGATGGTGCATATTTTGGAACCTCATTCCCTCACATGCTTTTTCAGGTATACCCTGAACTTGCGGTC---------CCTAAATCTCAAGAACGCTAC
CSK2B_ARATH/101-275 TGGATATCTTGGTTTTGTAATCTAAGAGGAAACGAGTTCTTTTGTGAAGTTGATGATGATTACATTCAAGATGACTTCAACTTGTGTGGACTCAGCAGTCTAGTTCCCTACTACGAGTACGCTCTTGATTTGATTTTGGATGTTGAATCTTCTCAAGGAGAGATG---TTTACAGAG---------------------------------------------------------------------------------------GAACAGAATGAATTGATCGAGTCAGCAGCTGAGATGTTGTATGGACTGATTCATGCTCGTTACATATTGACTAGCAAAGGATTGGCAGCAATGTTAGACAAATACAAAAACTATGACTTTGGAAGATGTCCAAGAGTTTATTGCTGTGGCCAACCTTGTCTTCCGGTTGGTCAATCAGACTTACCGCGATCTAGCACTGTGAAGATATATTGCCCGAAATGCGAAGACATTTATTACCCACGATCAAAGTATCAAGGCAACATTGATGGAGCTTACTTTGGGACAACGTTTCCACATCTGTTCCTGATGACTTATGGGCATCTCAAGCCA---------GCGAAGGCAACACAAAACTAT
CSK2B_YEAST/26-233 TGGATTCCATCGTTCTGTTCCAGATTTGGTCACGAGTACTTCTGCCAAGTCCCGACAGAGTTTATCGAGGATGATTTCAATATGACCTCGTTATCCCAAGAGGTACCCCACTACCGGAAAGCTCTGGATTTGATATTGGATTTGGAGGCTATGAGTGATGAAGAAGAGGACGAAGACGACGTGGTGGAAGAAGACGAAGTGGATCAAGAGATGCAGAGTAATGACGGTCATGATGAAGGCAAAAGGAGAAACAAGTCGCCAGTGGTGAACAAGAGTATTATCGAGCACGCAGCAGAACAGTTATACGGATTGATACATGCAAGATTTATTCTGACCAAGCCAGGCCTGCAAGCAATGGCTGAAAAATTCGACCACAAGGAATTTGGAACGTGCCCCCGTTACTATTGTAATGGCATGCAGTTGCTGCCTTGTGGGTTGAGCGATACAGTTGGGAAACACACCGTAAGGTTGTACTGTCCCAGTTGTCAGGACTTGTATCTTCCCCAATCATCTAGATTCCTGTGCTTAGAAGGTGCATTTTGGGGGACAAGCTTCCCTGGTGTGTTCTTGAAACATTTCAAAGAATTGGAAGAGTATGTGGAAAGGAAAAGTAAAGAGTCCTAC