EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01154 alignment
(7 sequences with 1389 bp)


HMCS_YEAST/45-490 AGACCTCAAAATGTCGGTATTAAAGGTATCCAAATTTACATCCCAACTCAATGTGTCAACCAATCTGAGCTAGAGAAATTTGATGGCGTTTCTCAAGGTAAATACACAATTGGTCTGGGCCAAACCAACATGTCTTTTGTCAATGACAGAGAAGATATCTACTCGATGTCCCTAACTGTTTTGTCTAAGTTGATCAAGAGTTACAACATCGACACCAACAAAATTGGTAGATTAGAAGTCGGTACTGAAACTCTGATTGACAAGTCCAAGTCTGTCAAGTCTGTCTTGATGCAATTGTTTGGTGAA------AACACTGACGTCGAAGGTATTGACACGCTTAATGCCTGTTACGGTGGTACCAACGCGTTGTTCAACTCTTTGAACTGGATTGAATCTAACGCATGGGATGGTAGAGACGCCATTGTAGTTTGCGGTGATATTGCCATCTACGATAAGGGTGCCGCAAGACCAACCGGTGGTGCCGGTACTGTTGCTATGTGGATCGGTCCTGATGCTCCAATTGTATTTGACTCT---GTAAGAGCTTCTTACATGGAACACGCCTACGATTTTTACAAGCCAGATTTCACCAGCGAATATCCTTACGTCGATGGTCATTTTTCATTAACTTGTTACGTCAAGGCTCTTGATCAAGTTTACAAGAGTTATTCCAAGAAGGCTATTTCTAAAGGGTTGGTTAGCGATCCCGCTGGTtcggatGCTTTGAACGTTTTGAAATATTTCGACTACAACGTTTTCCATGTTCCAACCTGTAAATTGGTCACAAAATCATACGGTAGATTACTATATAACGATTTCAGAGCCAATCCT---------------CAATTGTTCCCAGAAGTTGACGCCGAATTAGCTACTCGCGATTATGACGAATCTTTAACCGATAAGAACATTGAAAAAACTTTTGTTAATGTTGCTAAGCCATTCCACAAAGAGAGAGTTGCCCAATCTTTGATTGTTCCAACAAACACAGGTAACATGTACACCGCATCTGTTTATGCCGCCTTTGCATCTCTATTAAACTATGTTGGATCTGACGACTTACAAGGCAAGCGTGTTGGTTTATTTTCTTACGGTTCCGGTTTAGCTGCATCTCTATATTCTTGCAAAATTGTTGGTGAC---------------------GTCCAACATATTATCAAGGAATTAGATATTACTAACAAATTAGCCAAGAGAATCACCGAAACTCCAAAGGATTACGAAGCTGCCATCGAATTGAGAGAAAATGCCCATTTGAAGAAGAACTTC------AAACCTCAAGGTTCCATTGAGCATTTGCAAAGTGGTGTTTACTACTTGACCAACATCGATGACAAATTTAGAAGATCTTACGATGTTAAA
HMCS_SCHPO/4-446 GATAGAAAAGATATTGGTATTAAGGGCCTCGTGTTGTACACTCCCAATCAGTATGTTGAACAAGCTGCCCTCGAAGCGCATGATGGAGTCTCTACTGGAAAGTATACTATTGGCCTCGGCTTGACTAAGATGGCTTTTGTCGACGATCGTGAAGACATTTATTCCTTTGGTCTTACCGCTCTTTCTCAACTTATCAAGAGATACCAAATTGATATAAGCAAGATTGGTCGTTTGGAAGTTGGAACTGAGACTATCATCGATAAATCTAAGTCTGTCAAAAGTGTTTTAATGCAACTTTTTGGGGAT------AACCACAATGTCGAAGGTATTGATTGTGTTAATGCCTGTTATGGTGGCGTGAACGCTCTTTTTAACACAATCGATTGGATTGAGTCTTCTGCTTGGGATGGCCGTGATGGTATAGTTGTCGCTGGTGATATTGCTCTCTATGCCAAGGGCAATGCTCGTCCTACCGGTGGTGCTGGTTGTGTCGCCCTTTTGGTTGGTCCTAATGCCCCTATTGTTTTTGAACCTGGTCTACGTGGTACTTACATGCAACATGCTTACGATTTTTACAAACCCGATTTGACGAGTGAATACCCTTACGTTGATGGCCATTTTTCTCTTGAATGTTATGTTAAAGCTCTTGATGGAGCATATGCTAATTACAATGTTCGTGATGTTGCTAAGAATGGAAAAAGTCAAGGACTTGGA......------------TTGGATCGTTTTGATTATTGCATTTTCCACGCTCCTACTTGCAAACAAGTCCAAAAAGCATATGCGCGTTTATTGTACACCGATAGCGCTGCTGAACCATCTAAT---------CCCGAGTTGGAAGGTGTCCGTGAACTTCTTAGCACCCTGGATGCTAAGAAATCCCTTACCGACAAGGCTTTAGAAAAAGGTCTTATGGCCATAACTAAAGAGCGTTTTAACAAACGAGTTTCCCCTAGTGTCTATGCCCCTACCAACTGTGGTAATATGTACACTGCCAGTATTTTCTCTTGTTTAACTGCATTACTTAGCCGTGTCCCCGCTGATGAACTTAAAGGAAAACGCGTCGGTGCTTACTCTTATGGTTCTGGTTTGGCTGCCTCGTTTTTTTCATTCGTTGTCAAAGGCGAC---------------------GTCTCTGAAATTGCCAAGAAAACTAACTTGGTTAACGATTTGGATAATCGTCATTGTTTAACCCCTACGCAGTATGAAGAGGCTATTGAGCTACGCCATCAAGCACACTTGAAAAAGAATTTT------ACTCCCAAAGGAAGCATCGAACGTCTTCGTTCAGGTACTTACTACCTTACTGGTATTGATGACATGTTCCGCCGTAGCTATTCGGTGAAG
HMCS_CHICK/13-470 TGGCCCAAAGATGTGGGTATTGTTGCACTGGAAATCTATTTTCCCTCTCAGTATGTCGACCAGACTGAGCTGGAGAAGTATGACGGTGTGGATGCAGGCAAATACACCATTGGGTTAGGCCAGTCAAAGATGGGCTTCTGCTCTGACCGAGAGGATATCAATTCCCTCTGTTTGACTGTCGTTCAGAAGCTTATGGAGAGGAACAGCCTTTCCTATGACTGCATTGGGAGACTGGAAGTTGGAACGGAGACAATAATTGATAAATCAAAATCGGTGAAGACTGTCCTGATGCAGCTATTTGAAGAATCTGGTAATACAGATGTAGAAGGAATTGACACAACCAATGCGTGCTATGGAGGCACTGCTGCTCTTTTTAATGCTATTAACTGGATTGAGTCCAGTTCTTGGGATGGACGCTATGCACTTGTTGTTGCTGGAGACATTGCTGTGTATGCCACTGGAAATGCCAGGCCAACAGGTGGAGCTGGTGCTGTTGCTATGCTAGTTGGGTCAAATGCTCCTTTAATTTTTGAGAGAGGATTGCGTGGAACCCACATGCAGCATGCTTATGACTTCTATAAACCAGATATGGTTTCTGAATATCCTGTAGTTGATGGCAAACTATCTATACAGTGCTACCTCAGTGCATTAGACCGCTGCTATAGTGTTTATCGCAATAAAATCCATGCCCAGTGGCAAAAAGAGGGGACAGAC---......AGAGGTTTCACCTTGAATGATTTTGGATTCATGATCTTTCATTCTCCCTACTGTAAACTGGTACAGAAGTCGGTGGCAAGACTGTTGCTGAATGACTTTCTCAGTGACCAGAATGCAGAAACAGCAAATGGTGTTTTCAGTGGTCTGGAAGCTTTCAGGGATGTAAAGCTTGAAGATACATATTTTGATAGGGATGTGGAAAAAGCTTTTATGAAAGCTAGTGCAGAGCTCTTCAATCAGAAAACCAAAGCTTCCTTACTTGTGTCCAATCAGAATGGAAACATGTACACGCCTTCAGTCTACGGTTGCCTTGCTTCTCTTCTAGCCCAGTACTCTCCAGAGCACCTTGCAGGACAAAGAATCAGTGAGTTCTCATATGGCTCTGGTTTTGCTGCTACGCTGTATTCCATCAGAGTTACACAGGATGCCACTCCTGGTTCTGCGCTTGACAAAATAACTGCTAGCCTTTCTGATCTTAAAGCAAGACTTGACTCACGAAAATGCATTGCACCTGATGTCTTTGCTGAAAACATGAAGATTAGACAGGAGACACATCACTTGGCCAACTAT------ATTCCACAGTGTTCAGTAGAAGATCTCTTTGAGGGAACATGGTATCTTGTGCGTGTGGATGAAAAACACAGGAGAACATATGCACGACGC
HMCM_HUMAN/50-506 TGGCCAAAGGACGTGGGCATCCTGGCCCTGGAGGTCTACTTCCCAGCCCAATATGTGGACCAAACTGACCTGGAGAAGTATAACAATGTGGAAGCAGGAAAGTATACAGTGGGCTTGGGCCAGACCCGTATGGGCTTCTGCTCAGTCCAAGAGGACATCAACTCCCTGTGCCTGACGGTGGTGCAACGGCTGATGGAGCGCATACAGCTCCCATGGGACTCTGTGGGCAGGCTGGAAGTAGGCACTGAGACCATCATTGACAAGTCCAAAGCTGTCAAAACAGTGCTCATGGAACTCTTCCAGGATTCAGGCAATACTGATATTGAGGGCATAGATACCACCAATGCCTGCTACGGTGGTACTGCCTCCCTCTTCAATGCTGCCAACTGGATGGAGTCCAGTTCCTGGGATGGTCGTTATGCCATGGTGGTCTGTGGAGACATTGCCGTCTATCCCAGTGGTAATGCTCGTCCCACAGGTGGGGCCGGAGCTGTGGCTATGCTGATTGGCCCAAAGGCCCCTCTGGCCCTGGAGCGAGGGCTGAGGGGAACCCATATGGAGAATGTGTATGACTTCTACAAACCAAATTTGGCCTCGGAGTACCCAATAGTGGATGGGAAGCTTTCCATCCAGTGCTACTTGCGGGCCTTGGATCGATGTTACACATCATACCGTAAAAAAATCCAGAATCAGTGGAAGCAAGCTGGCAGCGAT---......CGACCCTTCACCCTTGACGATTTACAGTATATGATCTTTCATACACCCTTTTGCAAGATGGTCCAGAAGTCTCTGGCTCGCCTGATGTTCAATGACTTCCTGTCA---GCCAGCAGTGACACACAAACCAGCTTATATAAGGGGCTGGAGGCTTTCGGGGGGCTAAAGCTGGAAGACACCTACACCAACAAGGACCTGGATAAAGCACTTCTAAAGGCCTCTCAGGACATGTTCGACAAGAAAACCAAGGCTTCCCTTTACCTCTCCACTCACAATGGGAACATGTACACCTCATCCCTGTACGGGTGCCTGGCCTCGCTTCTGTCCCACCACTCTGCCCAAGAACTGGCTGGCTCCAGGATTGGTGCCTTCTCTTATGGCTCTGGTTTAGCAGCAAGTTTCTTTTCATTTCGAGTATCCCAGGATGCTGCTCCAGGCTCTCCCCTGGACAAGTTGGTGTCCAGCACATCAGACCTGCCAAAACGCCTAGCCTCCCGAAAGTGTGTGTCTCCTGAGGAGTTCACAGAAATAATGAACCAAAGAGAGCAATTCTACCATAAGGTGAATTTC------TCCCCACCTGGTGACACAAACAGCCTTTTCCCAGGTACTTGGTACCTGGAGCGAGTGGACGAGCAGCATCGCCGAAAGTATGCCCGGCGT
HMC2_BLAGE/4-455 TGGCCTGAGGATGTTGGTATAATTGGAATTGAGATGATTTTTCCTTCACTGTATGTGGACCAGGCTGAATTAGAGACTTATGATGAAGTCTCTCCAGGAAAGTATACAATGGGCCTAGGACAAGACAAAATGGGAGTATGCACAGACAGGGAGGACATCAACTCCTTGTGTCTCACTGCTGTGGATAAGCTCATGGAAAGGAATAATATAGATTATAACGACATTGGATGGCTGGAAGTAGGAACAGAAACTATCTTGGACAAAGTCAAGAGTGTAAAAACTGTACTTATGCAACTATTTGAAGAAAGTGGTAACACAGATGTGGAAGGAATTGACACCATAAATGCATGTTATCGTGGAACAGCGGCGTTATTCAATGCATTAATCTGGATAGAATCCAGCTCATGGGATGGTCGCTATGCCATTGTAGTTGCAGCAGATATAGCCATATATGCGAAG---GAATGCTCGCCCACTGGTGGAGCTGGAGCGTTGCTAATGTTAATTGGAGCCAATGCACCCATCGTCATAGACAGAGGTGTTCGTGCATCACATATGAAACATGCATATGATTTCTATAAGCCAGACCTGATGTCTGAGTATCCTGTAGTTGATGGTAAACTTTCTGTACAGTGTTACCTGAGTGCCCTAGATCACTGTTATCCACGGTTCTGCTCCAAAACTGAAAAATATCTCAAGAGATGTGGGAAAGAAAAT......ACAAAAATTGATCTTGACTACTTTGATGCTTTTGTTTTCCACTCACCATACTGCAAGCTAGTGCAAAAGTCAGTGGCACGACTTGTACTGAATGACTTCATTCAGTACCCTGAG------------------AAATACCAGGATCTTCAACAATTAAGAAACCTAAAATTTGAAGATACCTATTTTGACCGCGACATTGAAAAAATATTCATGGATAAAAGTAAGCAATTATTTGAAAAGAAGACTAAACCATCCCTCATGTTGGCTAATCAAGTAGGAAATATGTACACTACATCTCTATATGGAGGACTGGTGTCTCTACTCATTAGTGAAGACATTGGAGAACTGGCAGGAAAATGCATCTGCATGTTTTCTTATGGCTCAGGGTTTGCAGCAAGCATGTTCTCTCTTCACATCTCCACAGATTCAAGTCCAGGATCTACTCTCAGTCGACTAGTCACAAATCTTACTCACATAAAACCTCAAGTACAACAACGAGTGAAGTTATCTCCAGGAGAATTTGAAAACATTATGGAGATCCGAGAACAAAACCATCATAAAGCTCCTTAT------ACTCCAGTGGCTTCACCCAATACACTCTTTCCAGGAACCTGGTATCTGGAATCAATAGACTCAATGCATCGGCGAAAATATAAGCGTGTT
HMC1_BLAGE/2-451 TGGCCGTCAGACGTAGGTATTGTGGCTCTGGAGCTCATATTCCCTTCGCAGTATGTGGATCAGGTGGACCTCGAGGTCTACGACAATGTTTCTGCAGGAAAGTACACGGTGGGGTTGGGACAGGCTCGCATGGGGTTCTGCACGGACAGGGAGGACATCAACTCTCTGTGTCTCACCGTCGTCAGTCGACTGATGGAACGATGGAGCATCCCCTACTCGCAAATTGGGCGCCTGGAAGTAGGCACCGAGACCCTTCTGGACAAGTCGAAGAGCGTCAAGACTGTCCTGATGCAACTCTTCAAGGAC------AACACGGACATCGAGGGCGTGGATACCGTGAACGCCTGTTACGGGGGCACCTCGGCTCTCTTCAATGCGATTTCGTGGGTGGAGTCCAGCTCCTGGGATGGCAGGTATGCTCTTGTGGTCGCTGGGGACATTGCTGTGTATGCTAAAGGCAGTGCGAGGCCCACCGGTGGAGCAGGGGCTGTGGCCATGCTAGTGGGCGCCAATGCTCCCCTAGTGTTCGACAGAGGAGTTCGTTCATCACACATGCAACATGCTTATGACTTCTACAAACCGGATCTGTCCTCGCTGTACCCCACCGTGGATGGCAAGCTGTCAATTCAATGCTATCTTAGTGCCTTAGATCATTGTTATCAACTGTACTGCTCCAAGATCCAGAAACAACTTGGA------------------......GAGAAGTTCGATATTGAGCGGCTGGATGCAGTTCTCTTCCACGCGCCTTATTGTAAGTTGGTGCAGAAGTCTCTTGCTCGCCTCGTCTTGAACGACTTTGTGCGGGCATCAGAGGAGGAGCGGACGACT---AAATACTCCAGTCTGGAAGCACTAAAAGGCGTGAAGCTAGAAGATACGTACTTCGACCGAGAAGTTGAGAAAGCAGTCATGACATACAGCAAGAACATGTTTGAAGAGAAAACAAAGCCCTCGCTGTTGCTCGCCAACCAAGTCGGCAACATGTACACTCCTTCGCTTTACGGAGGTTTGGTCTCTCTATTGGTCAGCAAGAGCGCCCAGGAGTTGGCAGGGAAGCGCGTGGCCTTGTTTTCTTACGGCTCCGGACTGGCCTCTTCCATGTTCTCTCTAAGAATATCATCGGACGCCAGCGCGAAATCTTCTCTGCAACGCCTCGTCTCGAATCTCTCGCACATCAAGCCGCAGCTGGATCTGCGCCACAAGGTGTCACCAGAGGAGTTTGCACAAACGATGGAGACGAGGGAACACAACCACCACAAAGCTCCATAC------ACCCCAGAGGGCTCGATCGACGTCTTGTTTCCAGGAACTTGGTATCTGGAGAGCGTGGACAGCCTATACCGCCGCAGCTACAAGCAAGTT
HMCS_ARATH/1-451 ATGGCGAAGAACGTTGGGATTTTGGCTATGGATATCTATTTCCCTCCCACCTGTGTTCAACAGGAAGCTTTGGAAGCACATGATGGAGCAAGTAAAGGGAAATACACTATTGGACTTGGCCAAGATTGTTTAGCTTTTTGCACTGAGCTTGAAGATGTTATCTCTATGAGTTTCAATGCGGTGACATCACTTTTTGAGAAGTATAAGATTGACCCTAACCAAATCGGGCGTCTTGAAGTAGGAAGTGAGACTGTTATTGACAAAAGCAAGTCCATCAAGACCTTCTTGATGCAGCTCTTTGAGAAATGTGGAAACACTGATGTCGAAGGTGTTGACTCGACCAATGCTTGCTATGGTGGAACTGCAGCTTTGTTAAACTGTGTCAATTGGGTTGAGAGTAACTCTTGGGATGGACGTTATGGCCTCGTCATTTGTACTGACAGCGCGGTTTATGCAGAAGGACCCGCAAGGCCCACTGGAGGAGCTGCAGCGATTGCTATGTTGATAGGACCTGATGCTCCTATCGTTTTCGAAAGCAAATTGAGAGCAAGCCACATGGCTCATGTCTATGACTTTTACAAGCCCAATCTTGCTAGCGAGTACCCGGTTGTTGATGGTAAGCTTTCACAGACTTGCTACCTCATGGCTCTTGACTCCTGCTATAAACATTTATGCAACAAGTTCGAGAAGATCGAGGGC------------------......AAAGAGTTCTCCATAAATGATGCTGATTACATTGTTTTCCATTCTCCATACAATAAACTTGTACAGAAAAGCTTTGCTCGTCTCTTGTACAACGACTTCTTGAGAAACGCAAGCTCC---ATTGACGAGGCTGCCAAAGAAAAGTTCACCCCTTATTCATCTTTGACCCTTGACGAGAGTTACCAAAGCCGTGATCTTGAAAAGGTGTCACAACAAATTGCGAAACCGTTTTATGATGCTAAAGTGCAACCAACGACTTTAATACCAAAGGAAGTCGGTAACATGTACACTGCTTCTCTCTACGCTGCATTTGCTTCC---CTCATCCACAAGAAACACAATGATTTGGCGGGAAAGCGGGTGGTTATGTTCTCTTATGGAAGTGGCTCAACCGCAACAATGTTCTCATTACGCCTCAACGACAATAAGCCTCCTTTCAGC------ATTTCAAACATTGCATCTGTAATGGATGTTGGCGGTAAATTGAAAGCTAGACATGAGTATGCACCTGAGAAGTTTGTGGAGACAATGAAGCTAATGGAACATAGGTATGGAGCAAAGGACTTTGTGACAACCAAGGAGGGTATTATAGATCTTTTGGCACCGGGAACTTATTATCTGAAAGAGGTTGATTCCTTGTACCGGAGATTCTATGGCAAGAAA