EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF01018 alignment
(9 sequences with 750 bp)


Y384_MYCGE/3-158 ATTACAGATTATTGTGAGTGTCGCTTTACTGCTGGAAATGGTGGTAATGGAATCATAGCATGAAAAAGAGAAGCACATTATGATAAAGGTGGTCCTGGTGGTGGTAATGGTGGTAATGGTGGTAATGTTATTTTGCAAGCTGATCATAACTGCGATTCACTTTTTTTCTTGAAGAATAAAAAACACCTGTTTGCAGAAGATGGACAAAATGGTAAACCAGATTTAGCACATGGTAAAAATGGTTCAGATCTTTTAATTAAAGTGCCAATAGGAACAACAGTTAAAAACTTAGAAAATAATAGTGTATTGGTGGATTTTGTTCATGATAAACAGAGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATTTTGTGTTTTGGCGGAAAAGGCGGAAAAGGAAATGCTGCTTTTAAAAGCCCAATTATGCGTGCTCCTAATCTATATGAAAATGGTGATAAAGGAGAGATTTTAAACGTTAGTTTGGAAGTTAAATAT
MTG2_YEAST/91-338 TTCGTGGATGTTCGAATAGTGAAATGCAAAAGTGGCGCTGGTGGAAGTGGAGCTGTCTCCTTCTTTAGGGATGCAGGGAGGTCTATAGGTCCTCCGGATGGTGGAGATGGGGGAGCTGGTGGTAGTGTTTATATTCAAGCTGTTGCGGGGTTGGGATCTCTGGCG------AAGATGAAGACCACATATACCGCTGAAGACGGAGAAGCAGGTGCTGCCAGGCAACTGGATGGCATGCGAGGAAGAGATGTTTTAATACAAGTTCCTGTGGGTACTGTTGTAAAATGGTGCTTACCACCCCAAAAAGTTCGAGAGCTCGTGGAAAGAGAAATGCGCAAAGACAATAATGCTACATTAAGGTCTATACTTGGCTCAACAGCCGTCAACTTAAGCGTTTCTTCTGGTTCTCATCGGAAAAAAATACAACTATACAGACATGAAATGGCGGAGAGTTGGCTCTTCAAGGACAAGGCCAAGGAATACCATGAGAATAAGGACTGGTTCAAAGATTTACATAAGAAAATGGAGGCATACGACCACTCGTTAGAACAATCTGAACTGTTTAATGATCAGTTTCCACTGGCTGGTCTTGACTTAAATCAGCCAATGACGAAACCAGTATGTCTGCTGAAAGGTGGCCAAGGTGGACTCGGTAACATGCACTTTTTAACAAATTTGATTAGAAATCCAAGATTTTCCAAACCCGGCAGGAATGGGTTGGAACAGCATTTTTTATTCGAATTGAAAAGC
YHBZ_ECOLI/3-158 TTTGTTGATGAAGCATCGATTCTGGTCGTTGCAGGTGATGGCGGTAATGGTTGCGTGAGCTTCCGCCGCGAAAAGTATATTCCGAAAGGCGGCCCGGATGGCGGCGACGGCGGTGATGGTGGTGACGTATGGATGGAAGCCGACGAGAACCTGAACACGCTTATCGATTATCGTTTTGAAAAATCTTTCCGTGCAGAGCGCGGTCAGAATGGCGCAAGCCGCGACTGTACCGGTAAGCGCGGTAAAGACGTGACGATTAAAGTGCCGGTAGGTACGCGTGTAATCGACCAGGGTACTGGTGAAACCATGGGCGATATGACCAAACACGGTCAGCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCTGGTTGCTAAGGGCGGCTGGCACGGTCTGGGCAATACCCGTTTCAAATCGTCCGTTAACCGTACACCGCGGCAGAAAACCAACGGCACGCCGGGCGATAAGCGCGAGCTGCTGCTGGAGCTGATGCTG
O30861_CAUCR/3-158 TTCTTGGACCAATGCAAGATCTATATCCGCTCCGGTAACGGCGGCGGCGGATCGGTGTCGTTCCGCCGCGAGAAGTACATCGAGTACGGCGGCCCGGACGGCGGCGACGGCGGTCGCGGCGGCGACGTGTGGATCGAGGCCGTCGAAGGCCTCAACACCCTGATCGACTATCGCTATCAGCAGCACTTCAAGGCCGGCACGGGCGTGCACGGCATGGGCCGAGCGCGGCATGGCGCGGCCGGCGAAGACGTCGTCCTGAAGGTTCCGGTGGGCACCGAGGTGCTGGAGGAAGACAAGGAAACCCTGATCGCCGACCTTGACCACGCCGGCATGCGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTGCTGCTGGCCAAGGGCGGCAACGGCGGCTGGGGCAACCTGCACTTCAAGGGCCCGGTCAATCAGGCGCCGAAATACGCCAATCCCGGTCAGGAGGGCGAGGAGCGCTGGATCTGGCTTCGCCTGAAGCTG
OBG_BACSU/2-157 TTTGTAGATCAGGTCAAAGTATATGTAAAAGGCGGCGACGGCGGCAACGGTATGGTTGCGTTTCGCCGTGAAAAATATGTGCCGAAAGGCGGCCCTGCCGGCGGTGACGGAGGAAAGGGAGGAGACGTCGTTTTTGAAGTAGATGAAGGTCTCCGCACCCTGATGGATTTTAGATACAAAAAACACTTTAAAGCGATTCGCGGCGAGCATGGCATGTCCAAAAACCAGCACGGGCGAAATGCTGATGATATGGTCATTAAAGTTCCGCCGGGCACCGTTGTGACAGACGATGATACAAAACAGGTCATCGCTGATTTAACAGAGCACGGACAGCGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTGTCATTGCAAGAGGCGGAAGAGGCGGAAGAGGAAATAGCCGCTTTGCTACACCGGCTAATCCCGCGCCTCAGCTTTCAGAAAACGGCGAGCCGGGAAAAGAACGCTACATTGTTCTTGAATTAAAAGTG
Y303_HELPY/2-155 TTTGTAGATAGCGTGGAAATTATCATCGCTTCGGGTAAGGGGGGGCCTGGAATGGTGAGTTTTAGGCGAGAAAAATTTGTCATCAAAGGAGGCCCTGATGGGGGCGATGGAGGCGATGGAGGCGATGTGTATTTTGAAGTGGATAACAATACCGACACTCTAGCGAGTTTTAGAGGCACCAAACACCATAAGGCTAAAAATGGGGCTCCAGGAGGTACACGAAATTGCGCGGGCAAAAAGGGCGAAGACAAGATCATTGTCGTGCCACCAGGAACGCAGGTTTTT------GTAGGTGATGAGTTGTGGCTTGATTTAGTGGAACCTAAAGAAAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGTTAGCCTTAAAAGGGGGCAAGGGGGGGTTAGGGAATGCACATTTTAAAAGCGCGACTAAACAACAACCCACTTACGCGCAAAAAGGCTTAGAGGGGGTTGAAAAATGCGTGCGTTTGGAATTAAAACTC
P72931_SYNY3/3-158 TTTATTGATCAAGCGGAGATCGAAGTTCAGGGCGGCAAAGGCGGCGATGGCATGGTGTCCTTTCGGCGGGAAAAGTATGTGCCAGCAGGGGGCCCTTCCGGGGGCAATGGGGGCCGGGGTGGCTCGGTAATTTTTGAAGCGGATGCCAATCTGCAAACCCTGTTGGATTTTCGCTACGCCAGGATTTTTAAAGCGGAAGACGGCAAAAAAGGCGGCTCTAGCAATTGCACCGGGGCCAATGGCAAGGATGTGGTGGTGCAAGTTCCCTGTGGCACCATGGTGTATGACTTGGACGGGGAATGCCTCTTGGGAGATTTAGTTAGCCCTGGGCAAAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTTGTGTGGCGGCGGGGGGCAAAGGTGGTTTGGGTAATCAACATTTCCTTAGCAACCGCAACCGGGCTCCGGAATACGCCCTACCGGGATTGGAGGGGGAACAGCGACAGCTACGGCTAGAGCTAAAACTG
P95722_STRCO/4-158 TTCGTGGACCGCGTCGAACTGCACGTCGCCGCGGGTAACGGAGGCCACGGCTGTGCCTCCGTCCACCGTGAGAAGTTCAAGCCGCTCGGCGGCCCGGACGGCGGCAACGGCGGCCGGGGCGGCGACGTGATCCTCACCGTGGACCAGTCGGTGACCACGCTCCTCGACTACCACCACTCCCCGCACCGCAAGGCCACCAACGGCAAGCCCGGCGAGGGCGGCAACCGTTCCGGCAAGGACGGCCAGGACCTGGTCCTGCCCGTGCCCGACGGCACCGTCGTCCTCGAC---GGCGCGGGCAACGTGCTGGCCGACCTGGTCGGCCACGGCACCTCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACGTCGCCGCGCAGGGCGGCCGGGGCGGCCTCGGCAACGCGGCGCTGGCCTCCGCGCGGCGCAAGGCGCCCGGCTTCGCGCTGCTCGGTGAGCCCGGCGACCTCCAGGACATCCACCTCGAGCTGAAGACC
P71909_MYCTU/4-158 TTTGTCGATCGGGTCGTCATCCACACCAGAGCGGGTTCGGGCGGTAACGGCTGCGCTTCGGTCCATCGCGAGAAATTCAAGCCGCTGGGCGGCCCCGATGGCGGAAATGGCGGCCGGGGCGGCAGCATCGTCTTCGTCGTCGATCCGCAAGTGCACACCCTGCTCGACTTCCATTTCCGCCCGCATCTCACCGCGGCTTCGGGCAAGCACGGGATGGGCAATAACCGCGACGGGGCCGCCGGCGCGGATTTGGAAGTGAAAGTTCCCGAAGGCACCGTGGTATTGGAC---GAGAACGGCCGGCTACTGGCCGACCTGGTCGGCGCGGGCACCCGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGAAGCCGCCGCCGGAGGCCGTGGCGGTTTGGGCAACGCCGCGCTGGCTTCCCGCGTGCGTAAGGCCCCCGGTTTCGCACTCCTCGGCGAAAAGGGACAGTCCCGAGACCTCACCTTGGAACTCAAGACC