EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF00980 alignment
(3 sequences with 1188 bp)


VS06_ROTBS/1-395 ATGGATGTGCTGTTCTCCATTGCGAAAACAGTTTCAGAGCTTAAAAAGAGAGTGGTAGTTGGAACAATTTACACTAATGTTGAAGACATAATTCAACAGACTAATGAGTTGATTAGAACTTTGAATGGAAGTACGTTCCATACTGGTGGCATTGGCACGCAACCTCAGAAAGACTGGGTTGTTCAACTTCCTCAACTAGGCACGACTCTACTTAATCTCGATGATAATTATGTGCAATCTGCAAGAGGTATAATTGATTATCTGGCCTCATTTATTGAAGCTGTATGTGATGATGAAATGGTTAGAGAAGCGTCAAGAAATGGAATGCAACCTCAATCACCAACATTAATCGCATTAGCTTCATCAAAATTCAAAACTATTAATTTCAATAATAGTTCTCAGTCTATCAAAAATTGGAGCGCTCAATCTAGACGTGAAAATCCAGTTTATGAATATAAGAATCCAATGGTTTTTGAATATAGAAATTCATATATTCTGCATCGCGCAGATCAACAGTTTGGAAATGCTATGGGATTGAGATATTATACAACAAGTAATACTTGTCAAATTGCAGCATTTGATTCTACTATGGCTGAGAATGCACCAAATAATACACAAAGGTTCATTTATCATGGAAGATTGAAGAGACCAATCTCTAATGTGCTAATGAAAGTTGAACGTGGCGCTCCAAATGTTAATAACCCAACAATACTACCAGATCCAACTAACCAAACTACGTGGTTGTTTAATCCAGTACAAGTGATGAACGGAACATTTACAATTGAGTTTTATAACAATGGCCAGTTAGTTGATATGGTTAGAAAT---ATGGGAATAGCAACTGTCAGAACTTTTGATTCATATAGGATTACGATAGATATGATTAGACCAGCTGCTATGACCCAGTATGTACAGCAATTGTTCCCTGTTGGTGGACCATACTCTCATCAAGCTGCTTATATGCTTACACTTAGTGTGCTGGATGCCACGACAGAATCTGTTTTGTGCGACTCTCATTCAGTCGATTATTCGATAGTTGCCAATACGAGAAGGGATTCAGCGATGCCAGCTGGAACGGTTTTCCAACCAGGATTTCCATGGGAACAGACGTTGTCCAACTACACGGTTGCTCAAGAGGATAATTTGGAAAGATTGTTGCTAGTTGCATCCGTGAAGAGAATGGTGATG
P87723_9REOV/1-396 ATGGAGGTTTTATATTCATTGTCAAAAACTCTTAAAGATGCTAGGGACAAAATTGTTGAAGGTACATTATATTCTAATGTCAGCGATCTTATTCAACAATTTAATCAAATGATAGTAACTATGAACGGAAATGACTTTCAAACTGGAGGAATTGGTAATTTACCTATTAGGAATTGGACTTTCGATTTTGGTCTATTAGGTACAACACTTTTAAATTTGGATGCTAATTACGTTGAGAATGCTAGAACTACAATTGAATATTTTATTGATTTTATTGATAATGTATGTATAGATGAAATGTCAAGAGAGTCTCAAAGAAATGGAGTAGCTCCACAATCTGAAGCGTTAAGAAAATTAGCAGGCATTAAATTCAAGAGAATAAATTTTAACAACTCATCTGAGTATATAGAAAACTGGAATTTACAAAATAGAAGACAACGTACCGGATTTGTTTTTCATAAACCTAATATATTTCCATACTCGGCTTCATTTACTTTAAATAGATCTCAACCAATGCATGATAATTTAATGGGAACTATGTGGCTTAATGCTGGATCAGAAATTCAAGTAGCTGGATTTGATTATTCATGCGCTATAAATGCACCAGCGAACATACAGCAATTTGAGCACATTGTCCAGCTTAGACGTGCGCTAACTACAGCTACTATAACTTTATTACCTGATGCAGAAAGATTCAGTTTTCCAAGAGTTATTAATTCAGCTGATGGTGCAACTACATGGCTCTTCAATCCAGTCATTTTAAGACCAAATAATGTTGAAGTAGAATTTTTGTTAAATGGGCAAATCATTAATACATATCAAGCTAGATTTGGCACTATTATTGCAAGAAATTTTGATACAATTCGGTTGTCATTCCAGTTAATGCGCCCGCCAAATATGACACCAGCTGTTAATGCACTATTTCCGCAAGCACAACCTTTTCAACACCATGCAACAGTTGGACTTACACTACGTATTGAATCTGCAGTTTGTGAATCAGTGCTTGCGGATGCTAATGAGACTCTGTTGGCGAATGTGACAGCAGTACGTCAAGAGTATGCTATTCCAGTTGGACCCGTATTTCCGCCAGGCATGAATTGGACTGAATTGATTACTAACTATTCACCATCTAGAGAAGACAATTTACAGCGTGTATTTACAGTAGCTTCCATTCGAAGCATGTTGATT
O39646_9REOV/1-396 ATGGATGTGCTTTATTCACTTGCCAAGACGCTGAAGGATGCTAGAGCCAGAATAATTGAAGGCACACTTTACACCAACGTAGCTGATATTGTACAACAAGTAAACCAAGTAATCAATTCACTTAATGGCTCAACTTTCCAGACTGGAGGAATCGGCAACTTGCCAGTTAGGAATTGGGCATTTGACTTTGGAACACTCGGAACGACCTTACTCAACTTGGACGCGAATTACGTCGAGAATGCAAGAACAACAATTGACTATTTCATCGATTTTGTTGACTCTGTTTGTGTTGATGAAATAGTGCGTGAATCTCAACGTAATGGAATAGCACCACAATCTGACTCACTGAGACAGCTTTCGAACGCTAAGTACAAAAGAATAAACTATGATAATGAATCAGAATACATAGAGAATTGGAATTTACAGAATAGAAGGCAGCGAACCGGCTATTTATTGCACAAACCAAACATTCTTCCATACAATAATTCATTTACTCTAATTAGATCTCAACCTGCGCATGATAATGTATGTGGAACAATTTGGTTGAATAATGGATCTGAAATTGAAATCGCTGGATTTGATTCTGAATGCGCACTGAATGCTCCGGGAAACATTCAAGAATTTGAACATGTTGTACCAATGCGAAGAGTGTTAAACAATGCTACAGTATCACTTTTACCATATGCACCAAGATTGACGCAGCGAGCAGTCATACCAACAGCTGATGGCTTGAATACGTGGCTTTTTAACCCAATTATATTGAGACCAAACAACGTACAAGTGGAATTTCTGTTGAATGGACAAGTAATAACAAACTACCAAGCCAGATACGGTACATTAGCTGCACGCAATTTCGACTCAATACGTATATCATTCCAACTTGTTAGACCGCCGAATATGACACCTGGAGTAGCAGCACTTCTTCCTCAGGCAGCACCATTTCCAAATCATGCGACAGTCGGTTTAACGTTGAGAATCGAATCTGCTTCTTGTGAATCAGTTTTATCAGACGCAAACGAACCGTACTTGTCAATTGTGACAGGTTTGAGGCAGGAATATGCGATTCCAGTAGGACCAGTATTTCCTAGCGGTATGAACTGGACTGAGTTGCTTAATAATTATTCAGCATCCAGAGAAGATAACTTGCAACGTATATTTACAGCAGCATCCATTCGGAGCATGATTATT