EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF00952 alignment
(7 sequences with 687 bp)


Q88923_9VIRU/6-234 TTTTATGATGCTCCATCAACAGGTGCAAACGGATTTGATCCCGATGCAGGGTATGTGGCATTTATTGCTGCACATGCCGGATCGTACGATCTTTCTGCTGTTAGGATCTTCTTCCTCAATGCTGCCAAGGCCAAGAATGCTCTCTCGAGAAAACCAGAGGGGAAGGTTAGTATTAAATTTGGCGAGTGGTCGGTGGAGGTGGTCAATAATCATTTTCCTGGCAACAGGAACAATCCAATTGGTAACAACGATCTTACCATCCACAGAATTTCAGGCTATCTCGCAAGATGGGTTCTAGAAGAGTTCAAAGGACAAGATGATGAAGCCCAGAAGGACATCATCCGCTCAACCATTGTGAACCCAATTGCAGAATCCAATGGGATCCACTGGGATAGCGGTGCAGATGCCTACCTGTCATTCTTCCCTGGCACTGAAATGTTTCTGGAATCATTTGATTTCCTCCCATTAGCAATTGGGATCTATAGAGTCAAAAATGGCATGATGGATGTCCAATACCTGAAAAAAGCTCTCCGTCAAAGATACGGGACTATGACAGCAGATAAGTGGATGTCTACTAAGACAACAGTAATTGCAAAGACCCTGAAGAGAGTTGAGAGCTTCAAATGGGGTAAGGGAGGACTAAGTGAGGCAGCCAGAGCATTCCTCTCAAAATTTAATGTAAAAATA
NCAP_BUNLC/6-234 TTTTATGATGTCGCATCAACAGGTGCAAATGGATTTGATCCTGATGCAGGGTATATGGACTTCTGTGTTAAAAATGCAGAATCACTCAACCTTGCTGCAGTTAGGATCTTCTTCCTCAATGCCGCAAAGGCCAAGGCTGCTCTCTCGCGTAAGCCAGAGAGGAAGGCTAACCCTAAATTTGGAGAGTGGCAGGTGGAGGTTATCAATAATCATTTTCCTGGAAACAGGAACAACCCAATTGGTAACAACGATCTTACCATCCACAGATTATCTGGGTATTTAGCCAGATGGGTCCTTGATCAGTATAACGAGAATGATGATGAGTCTCAGCACGAGTTGATCAGAACAACTATTATCAACCCAATTGCTGAGTCTAATGGTGTGGGATGGGACAGTGGGCCAGAGATCTATCTATCATTCTTTCCAGGAACAGAAATGTTTTTGGAAACTTTCAAATTCTACCCGCTGACCATTGGAATTCACAGAGTCAAGCAAGGCATGATGGACCCTCAATACCTGAAGAAGGCCTTAAGGCAACGCTATGGCACTCTCACAGCAGATAAGTGGATGTCACAGAAGGTTGCAGCAATTGCTAAGAGCCTGAAGGATGTAGAGCAGCTTAAATGGGGAAAAGGAGGCCTGAGCGATACTGCTAAAACATTCCTGCAGAAATTTGGCATCAGGCTT
Q65610_9VIRU/6-233 TTCCATGATGTCACTGCTAACACCAGCAGTACTTTTGATCCAGAAGCCGGGTATGCTGCGTTTAAGCGTAGACACACCACAGGGCTTAATTATGACCACATACGAATCTTCTTTCTTAACGGAAAGAAGGCTAAAGATACTCTCTCAAAGAGAAGTGAGACAACAATTACGCTTAACTTTGGGGGCTGGAAGATACCTGTGGTTAATACGCATTTTCTTGAGAACAGGAACATGTCAGTTCCAGATGATGGTCTTACCCTCCACAGAGTCAGTGGATATCTTGCCAGGTACCTGCTTGACAGAGTATACTCTGCTGGA---GAACCAGAGAAACTAAAAATAAAAACAACAATTATAAATCCGATTGCTGCTTCTCATGGTATAACGTGGGATGATGGAGAAGAAGTTTACTTATCCTTCTTCCCTGGCTCAGAGATGTACTTAACCACATTCAAATTTTACCCATTAGCTATTGGCATTTACAAGGTCCAGAGGAAATTGATGGACCCAAAGTATCTTGAGAAAACAATGCGTCAGAGGTACATGAACTTGGATGCATCCCAATGGACTCAGAAACACTTCTCAGATGTCAACAGTGCACTTACTGTAGTCGCTGGCTTAGGGTGGAAGAAAGCCAATGTTAGCATTGCAGCCAAAGATTTCCTGAATAAATTCGGAATAAACATC
Q65528_BUNYW/6-233 TTCTTTGACGTTGCTCAAAATGCAACAAGTACGTTTAACCCGGAGCTCCAATATGCTACATTTAAACGTACAAACACAACAGGGCTTAATTACGACAATATTAGAATCTTCTATCTCAATGGGAAGAGATCCAAAGATACTCTCTCTAAGAGAAGTGAACAATCGGTTGTTCTTAACTTTGGAGGCTGGAGAATTCCTGTGGTTAATACACATTTTCCTGGAAACCGGAACAGTCCAGTCCTCGATGATTCATTCACACTTCATAGAGTAAGTGGTTACCTGGCAAGGTACTTACTTGAAAGATATTTAACTGTATCA---GCACCTGAGCAAGCAATCATCAGGTCAAAAATCATAAACCCTATAGCTGCATCAAACGGGATCACATGGGAAGATGGACCAGAGGTTTATCTTTCCTTTTTCCCAGGTACTGAAATGTTCCTGGAGACTTTCAAATTCTACCCCCTTGCAATTGGAATATACAAAGTTCAGAAAAAGATGATGGAGGCTAAATACTTGGAGAAAACTATGAGACAGAAATATGCTGGGTTAGATGCATCTCAATGGACGCAACAAAAATATAATGAGATCAATGCTGCTCTTTCTGTTGTCTCATCACTAGGTTGGAAGAAAGCCAATGTTAGCTCTGCTGCTAGAGAATTTTTGGCTAGATTTGGAATATCTCTG
NCAP_BUNYW/6-233 TTTCATGATGTCGCTGCTAACACCAGCAGTACTTTTGACCCAGAGGTCGCATACGCTAACTTTAAGCGTGTCCACACCACTGGGCTTAGTTATGACCACATACGAATCTTCTACATTAAAGGACGCGAGATTAAAACTAGTCTCGCAAAAAGAAGTGAATGGGAAGTTACACTTAACCTTGGGGGCTGGAAGATTACTGTATATAATACGAATTTTCCTGGCAACCGGAACAACCCAGTTCCTGACGATGGTCTTACCCTCCACCGCCTCAGTGGATTCCTTGCCAGGTACCTACTTGAGAAGATGCTGAAAGTCAGT---GAACCAGAGAAATTGATTATTAAATCAAAAATAATCAACCCTTTGGCTGAAAAGAATGGGATCACTTGGAATGATGGAGAGGAAGTTTATCTCTCTTTCTTCCCAGGATCAGAGATGTTCTTAGGAACTTTCAGATTCTACCCCTTAGCAATCGGGATCTACAAAGTTCAGCGCAAGGAAATGGAACCAAAATACCTTGAGAAAACAATGCGGCAGAGGTACATGGGACTAGAAGCAGCAACTTGGACTGTTAGTAAATTGACAGAAGTTCAGTCTGCACTGACAGTTGTCTCTAGCTTAGGTTGGAAGAAAACCAATGTTAGTGCAGCTGCCAGGGACTTCCTTGCTAAATTCGGAATCAACATG
NCAP_BUNGE/6-233 TTTGAAGATGTCCCTAATAACATCGGGAGTACTTTTGACCCAGAGTCAGGATACACTAACTTTCAGCGTAACTACCTGCCAGGGGTTACGCTTGACCAAATTCGCATCTTCTACATTAAAGGACGCGAGATTAAAAATAGTCTCTCAAAAAGAAGTGAATGGGAAGTTACGCTTAACCTTGGGGGCTGGAAGGTACCTGTACTCAATACGAATTTCCCTGGAAACAGGAACAATGCAGTGCCTGACTACGGTCTTACCTTCCACCGTATCAGTGGATACCTTGCCCGGTACCTACTTGGAAAGTACCTTGCAGAGACA---GAACCAGAAAAGCTCATAATGAGAACAAAAATTGTGAACCCTCTTGCTGAGAAGAATGGCATCACATGGGAGAGCGGGCCAGAAGTCTACCTGTCCTTCTTCCCAGGTGCTGAAATGTTCCTTGGAACTTTCAGATTCTACCCACTTGCCATTGGGATCTACAAAGTGCAGAGGAAAGAAATGGACCCAAAATTTCTGGAGAAGACTATGCGCCAGAGGTACCTTGGCATTGATGCTCAGACATGGACAACAACTAAGCTTGGAGAAGTGGAAGCAGCTTTAAAAGTAGTCTCAGGGCTCGGATGGAAGAAGACAAATGTCAGCAGTGCTGCAAGGGAGTTCCTATCCAAATTCGGCATCAGGATG
NCAP_AINOV/7-233 TTCCAAGATGTTCCTCAACGGAATCTCGCTACGTTTAACCCGGAGGTCGGGTATGTGGCATTTATTGCTAAACATGGGGCCCAACTCAATTTCGATACCGTTAGATTCTTCTTCCTCAATCAGAAGAAGGCCAAGATGGTACTCAGTAAGACGGCACAACCAAGTGTTGATCTTACATTTGGTGGCATCAAGTTTACACTGGTTAATAACCATTTTCCCCAATACACAGCAAATCCTGTGCCAGACACTGCCCTCACTCTCCATCGTCTCTCAGGATATCTAGCAAAATGGGTTGCAGACCAATGTAAAACGAATCAG------ATTAAATTGGCTGAGGCCATGGAAAAAATTGTCATGCCACTGGCTGAAGTGAAAGGTTGCACCTGGACTGAAGGGCTGACTATGTATCTGGGATTTGCACCAGGTGCTGAAATGTTTTTAGAAACATTTGAATTCTACCCTTTGGTTATTGATATGCACAGAGTGCTGAAGGATGGAATGGATGTCAACTTCATGAGGAAGGTCCTTCGCCAGCGCTACGGCACATTGACTGCAGAACAGTGGATGACTCAAAAAATAGATGCTGTCCGTGCAGCCTTCAATGCTGTTGGGCAGCTAAGCTGGGCTAAATCAGGATTCTCACCAGCTGCTAGAGCCTTCCTTGCCCAATTTGGCATAAACATC