EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF00934 alignment
(9 sequences with 282 bp)


Q49943_MYCLE/2-95 CCCCTTTTCTTGAATGCAGAGCCACAGGCCCTGACCGCGGCAGCTAACACCTTGGAGGGCCTCAGTGCTGCCACAGTGGCAAGCAACGCCGCGGCGGCCCAGCTGACCACTGAAATTGCTCCCCCAGCTGCCGATGATGTGTCAATCTTGCTAGCACATTTTTTCAGTGGCCATGGGAGACAGTACCAGGCGCACGCCTCTCAGGGCGCGACCAATCATCAGGATCTAATCCAGAGCTTGTTGACGAGCTCGTCAGCATATGCGGGTACCGAGACTGCCAAT
PE23_MYCTU/1-94 ATGCAGTTCCTGAGCGTGATTCCAGAGCAGGTCGAGTCCGCGGCTCAAGATTTGGCGGGCATTCGCTCAGCGCTGAGCGCGTCTTACGCGGCCGCAGCGGGACCCACAACAGCGGTGGTTTCCGCTGCCGAGGACGAGGTGTCGACCGCGATTGCGTCGATATTCGGCGCCTACGGTCGACAGTGCCAGGTTCTCAGCGCCCAGGCCTCCGCGTTTCATGACGAGTTCGTCAACCTGTTGAAAACTGGCGCGACTGCATACCGCAACACCGAATTCGCCAAC
PG44_MYCTU/1-94 ATGTCGTTTGTCACGGCAGCTCCAGAGATGCTGGCGACGGCGGCGCAGAATGTCGCGAATATCGGCACATCGCTGAGTGCGGCAAACGCGACGGCAGCGGCGTCCACGACCTCGGTGCTGGCGGCCGGAGCCGACGAGGTATCGCAGGCTATCGCAAGGCTGTTCAGTGATTACGCCACGCACTATCAGTCGCTGAACGCTCAAGCCGCGGCATTTCATCACAGCTTCGTGCAAACGTTGAACGCCGCCGGTGGCGCCTATTCGAGCGCCGAGGCGGCCAAC
PG35_MYCTU/1-94 GTGTCATTTCTGGTCGTGGTTCCCGAGTTCTTGACGTCCGCGGCAGCGGATGTGGAGAACATAGGTTCCACACTGCGCGCGGCGAATGCCGCGGCTGCCGCCTCGACCACCGCGCTTGCGGCCGCTGGCGCTGATGAGGTATCGGCGGCGGTGGCAGCGCTGTTTGCCAGGTTCGGTCAGGAATATCAAGCGGTCAGCGCGCAGGCGAGCGCTTTCCATCAACAGTTCGTGCAGACGCTGAACTCGGCGTCAGGATCGTATGCGGCCGCGGAGGCCACCATC
PG46_MYCTU/1-94 ATGTCATTTGTGATTGCGGTGCCGGAAGCATTGACGATGGCGGCTTCGGATCTGGCCAACATTGGGTCGACGATCAACGCGGCGAATGCGGCGGCGGCATTGCCGACCACGGGGGTGGTGGCGGCTGCCGCGGATGAGGTTTCGGCGGCAGTTGCGGCCTTGTTCGGGTCGTACGCGCAGAGCTATCAGGCTTTTGGTGCGCAGCTGTCGGCGTTTCACGCCCAGTTCGTGCAGTCCCTTACGAACGGCGCGCGCTCATACGTAGTTGCCGAGGCCACCAGT
P71664_MYCTU/1-94 ATGTCGTTTTTGTTTGCACAGCCGGAAATGCTGGGCGCGGCGGCGACGGATCTGGCAAGCATCGGCTCGGCGATCAGCACGGCCAATGCTGCGGCCGCGGCCGCCACGACGCGTGTGCTGGCCGCCGGTGCCGATGAGGTGTCCGCCGCCGTGGCGGCGCTGTTTAGCGGCCACGCGCAGACCTATCAGGCGCTGAGAACTCAGGCGGCGGCGTTTCACCAGCAGATCGTGCAGACCCTCACGAGCACGGCAGGCGCGTATGCCAGCGCCGAGGCCGCCAAC
PG24_MYCTU/1-94 ATGTCGTTTGTAATCGCCGCTCCCGAGACGCTGGTGAGGGCCGCTTCGGATTTGGCGAACATCGGGTCGACGCTGGGGGCCGCCAACGCCGCGGCATTGGGCCCGACGACGGAACTTCTGGCAGCCGGTGCTGATGAGGTGTCGGCGGCCATCGCGTCGCTGTTCGCCGCGCATGGCCAGGCCTATCAGGCGGTGAGCGCTCAGATGTCGGCGTTTCATGCCCAGTTCGTTCAAACCTTTACTGCGGGCGCTGGCGCGTACGCGAGCGCTGAGGCCGCCGCC
WA22_MYCTU/1-94 ATGTCGTTTGTGATCGCGGTGCCGGAGACTATCGCGGCGGCGGCGACGGATCTAGCCGATCTCGGCTCGACGATCGCTGGGGCCAACGCGGCTGCGGCGGCCAACACGACGAGCCTGCTGGCCGCCGGTGCCGATGAGATCTCGGCGGCAATCGCTGCGTTGTTCGGCGCGCACGGCCGGGCCTATCAGGCGGCGAGCGCCGAGGCGGCGGCGTTTCATGGTCGGTTCGTGCAGGCGCTGACCACCGGGGGGGGCGCCTATGCGGCCGCCGAGGCCGCCGCC
P77909_MYCTU/2-95 GTGTCTTATGTTGTTGCGTTGCCGGAGGTGATGTCCGCCGCGGCCACAGACGTGGCTTCGATTGGTTCGGTGGTCGCGACGGCGAGCCAGGGTGTCGCGGGTGCCACCACGACGGTATTAGCCGCTGCCGAGGACGAGGTGTCAGCCGCGATCGCGGCTTTGTTTTCCGGCCATGGTCAGGACTATCAAGCTCTTAGCGCACAGCTTGCGGTGTTTCATGAGCGGTTTGTGCAGGCATTGACAGGCGCGGCCAAGGGGTATGCCGCCGCCGAGCTGGCCAAC