EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF00880 alignment
(137 sequences with 87 bp)


Q14215_HUMAN/74-102 GGTTCTGTGGAAGTGATGAGAGTGAAGAATGCCCAGAATCTCTTGAATGAAAGGCTGTATCGTATAAAGCCTGAGGCCCTCAAATTC
NEBU_HUMAN/3400-3428 GATTCCTTGGAAGTTGTTAGGGCCAAGAGAGCTGGAGAATTACTTAGTGATACTATCTACCGTCAGCGTCCAGAAACGCTGAAATTT
Q14214_HUMAN/1418-1446 GAGTCCCTGGAGGTGGAGAAGGCAAAGAAAGCAGGAGAGATTCTTAGTGAGAAGAAGTATCGCCAGCACCCCGAGAAGCTGAAGTTC
O35884_MOUSE/902-930 GGGTCATTACATGTGGAGCAGGCGAAGAAGGCAGGAGAACTCATTAGTGAGAAGAAGTACCGTCAGCACCCAGATGCTTTGAAGTTT
O35884_MOUSE/659-687 GGGAGTCTCAACCTGGAACAGGCGAAGAAGGCTGGACAGCTCATCAGCGAGAAAAACTACCGGCAGAGGGTGGATGAGCTGAAGTTC
O77813_RABIT/274-302 GGGCGCCCAGACATTGAAATGGCCAAGAAGGCAGCCAGGCTGAGCAGCCAGGTTAAATATCGAGAAAATTTCGACAAAGAGAAGGGA
O35884_MOUSE/311-339 ATCACCCCAGCGTATCAGACCGCCAAGAAGGCCAATGAACTTGTTAGTGACATAAAATACCGGCAGGACTTCCATAAGATGAAAGGT
NEBL_HUMAN/35-63 GAAGACTTAAGCATGGAATTGGCCAGAAAATGCACGGAACTCATTAGCGATATCCGTTATAAAGAAGAGTTTAAAAAGTCCAAGGAT
Q14215_HUMAN/1152-1180 AGCACCTTGTCCCTGACACACGCCAAGAACCAGAAGCATCTGGCCAGCCATATCAAATATCGGGAAGAATATGAAAAGTTCAAAGCT
Q14215_HUMAN/1818-1846 GACTCTCCGATCAATAGGCATTTCAAGTATGCAACTCAATTGATGAATGAGAAAAAATACAGAGCTGATTATGAGCAGCGGAAAGAT
O35884_MOUSE/692-720 GACAGCTCCCAGATGGAGCATGCCAAGAAGAGCCAGGGGCTGCAGAACGCGGTGGCCTACAAGGCAGGAAACGAGCAATCCGTCCAT
Q14214_HUMAN/14-42 CCTTGCTTTGAAGTTGCAAATGCCAGAATGAATGCTGATAACATTAGCACAAGGAAATACCAGGAAGATTTTGAAAACATGAAAGAC
NEBU_HUMAN/188-216 GATGCCCCTGAACTTGTCCAGGCCGTTAAGAACACCGCCATGTTCAGCAAGAAACTGTACACTGAAGACTGGGAAGCAGACAAAAGT
Q14214_HUMAN/2425-2453 GATTCCATACCAATGGTTTTGGCAAAAAACAATGCTATTACCATGAATCATCGCCTCTATACAGAAGCTTGGGATAAAGATAAAACC
NEBU_HUMAN/2947-2975 GACTCTCTGGAACAAGTGCTGGCCAAGAACAATGCTCTCAACATGAATAAGCGTTTATACACAGAGGCCTGGGACAAAGACAAGACT
NEBU_HUMAN/3676-3704 GACACTCCGGAAATTGTCCTAGCAAAGAATAATGCCCTGACAATGAGCAAGCATTTATACACAGAAGCTTGGGATGCTGACAAAACC
Q14214_HUMAN/1939-1967 GATTCCATGGACATGGTGCTTGCCAAGCAGAATGCACATACCATGAACAAGCATTTATACACCATTGATTGGAATAAAGATAAGACC
Q62412_MOUSE/978-1006 GATACTCCAGAAGTTGTCCTGGCAAAAGCCAATTCTCTGCAAATGAGTGAGAGGCTGTATCAGGAAGCCTGGAATAAGGATAAAACC
Q61953_MOUSE/216-244 GACACCATGGAACAGGCACTTAACAAAACAAACAAGCTGACTATGGATAAGAGGCTGTACACTGAGAAGTGGAACAAAGACAAGACC
Q14215_HUMAN/350-378 GACACACCTGAAGTGGTCCTTGCTAAATCAAATGCTGAAAATATTAGTATTCCAAAGTACAGAGAGGTTTGGGACAAGGATAAAACT
Q14214_HUMAN/2182-2210 GATGCCATGGATATAGTTCTGGCAAAGACAAATGCCAAAAATAGGAGTGATAGACTTTATAGAGAAGCTTGGGACAAAGACAAGACT
Q14214_HUMAN/1695-1723 GACTCGATGAACATGGTTTTGGCCCAGAATAATGCAAAAATTATGAACGAACATCTCTACAAACAAGCATGGGAGGCTGACAAAACC
Q62412_MOUSE/1013-1041 GACACCCCAGCGATGCTACAGGCCCAAATCAATGCCTTGCAGATTAGCAATAAACTCTATCAAAAAGACTGGGATGAAGCCAAGCAG
Q14215_HUMAN/142-170 GACACTCCCCTGATGCTGCAATCCAAAATCAATGCCCTGCAGATCAGCAATAAACGCTATCAGCAAGCTTGGGAAGATGTCAAGATG
Q14215_HUMAN/107-135 GACACCCCGGAAGTAATCCAGGCAAAGATCAATGCTGTACAGATCAGTGAGCCATTGTATCGCGATGCCTGGGAGAAAGAGAAGGCT
O35884_MOUSE/453-481 AACACGCCACAGATTGTTCAAGCTAAGATCAACGCCCAGCAGCTGAGCCATGTGAATTACCGAGCTGACTACGAGAGAAACAAGCTG
NEBU_HUMAN/3711-3739 GACACCCCAGATATCCTGCTGGCCAAGAGTAATTCTGCCAATATCAGCCAAAAACTTTACACCAAGGGATGGGATGAATCAAAGATG
Q14215_HUMAN/385-413 GATACTCCAGAAATTAATCTCGCTAGAGCAAATGCTCTTAATGTGAGCAATAAACTTTACCGTGAGGGCTGGGATGAAATGAAGGCG
Q14214_HUMAN/2217-2245 GATACACCTGACATTGTTCTGGCTAAAGCAAACTTAATCAACACAAGTGATAAACTCTACCGAATGGGTTATGAGGAGCTGAAGAGA
Q04020_RABIT/27-55 GATACTCCAGATATCCTTCTCTCCAGAGTAAACCAAATCACCATGAGTGATAAACTGTACAGAGCTGGCTGGGAAGAGGAGAAGAAG
NEBU_HUMAN/3468-3496 GATACACCAGAAATCATGTTAGCCAAACTCAACCGAATAAACTACAGTGATAAACTCTATAAACTTGCTTTGGAAGAGTCCAAGAAG
Q14214_HUMAN/1730-1758 GATATCCCCCAGATTATTTTGGCAAAGGCAAATGCAATTAATATGAGTGATAAACTCTACAAACTTTCCTTGGAAGAGTCTAAAAAG
NEBU_HUMAN/2982-3010 GATACACCAGAGATTATGTTGGCAAGGCAGAACAAAATCAACTACAGTGAGACTCTATACAAACTTGCCAATGAAGAAGCAAAAAAG
NEBU_HUMAN/2739-2767 GATACCCCTGAAGTTTTATTAGCTAAACAAAACAAAGTAAATTACAGTGAGAAATTGTATAAGCTTGGCCTAGAAGAAGCCAAGAGG
Q14214_HUMAN/1974-2002 GATACACCAGATATTTTACAAGCCAAGCAGAATCAAACACTGTATAGTCAGAAACTCTATAAACTTGGATGGGAAGAAGCTTTGAAG
Q14214_HUMAN/1242-1270 GAATTGCCTCAGTTTATTCAAGCCAAAGTCAACGCCCTCAACATGAGTGATGCTCATTATAAAGCAGATTGGAAGAAAACCATTGCC
Q14214_HUMAN/998-1026 GATCTTCCTCAGTTTCTCCAGGCCAAGTGCAATGCTTACAATATAAGTGACGTCTGTTATAAACGGGATTGGCATGACTTAATAGCC
Q14214_HUMAN/754-782 GACCTGCCCCAGTTCATCCAGGCTAAAGTTAATGCCTACAATATCAGTGAGAATATGTACAAAGCAGACTTGAAAGACTTGAGCAAG
Q14214_HUMAN/263-291 GATACTCCTGCTTTTATCCAGCACAAAGTCAATGCCTATAACTTGAGTGATAATCTTTATAAGCAAGACTGGGAGAAGAGCAAAGCC
O35884_MOUSE/727-755 GACGAGCCTCTCTTCTTACGAGCCCGGGCCAATGCTGCTCAACTCAGCGAGACCCTGTATAAGAGCAGCTGGGAAAAGCAGAAGGCT
O15500_HUMAN/7-35 GACCTCCCTGAAGTCCTGCTGGCCAAGCTGAATGCCATGAATATCAGTGAGACGCGTTATAAGGAATCCTGGAGCAAACTTCGAGAT
Q14214_HUMAN/1207-1235 GATTCCATGGGCATGGTGTTGGCTCAGCATAACACAAAGCAGCTAAGTGATTTGAACTACAAGGTAGAGGGAGAGAAACTGAAGCAC
Q14214_HUMAN/228-256 GACTCTCCTGTTCTGCTACAAGCCCAAGTCAATTCCAAACAACTGAGTGACTTAAATTACAAAGCAAAACATGAAAGTGAAAAGTTC
Q14214_HUMAN/963-991 GACTCCCCAGTTATGGTCCAGGCAAAACAGAACACGAAGCAAGTCAGTGATATCTTATACAAGGCTAAAGGAGAAGATGTGAAACAT
Q14214_HUMAN/719-747 GATGCTCCAATTACAGTACAGTCTAAAATTAACCAGGCCCAGAGGAGTGATATCGCTTACAAAGCCAAAGGAGAGGAAATTATTCAC
O35884_MOUSE/935-963 GACACTCCGGAGATGGTCCAGGCCAGGATTAGTTATACCCAAGCAGTGGATAGACTGTACAGGGAGCAAGGGGAGAATGTGAAGCAC
O77813_RABIT/598-626 GACACTCCAGAAATGCAGAGAGTCCGGGAGAACCAGAAGAACTTCAGCCTTCTGCAATACCAGTGTGACCTTAAAAACAGTAAAGGA
Q90684_CHICK/224-252 GATCCACCCGAACTAAGGAGAATCAAGGAAAACCAGAAGAATATAAGCAATGTTCACTATAAAGAGCAGCTCTGCAGGGCTACACCT
NEBL_HUMAN/700-728 GATCCACCAGAGCTGAAGAGGGCAAAAGAAAACCAGAAAAACATCAGCAATGTTTATTACAGAGGTCAGCTGGGAAGAGCTACCACT
O77813_RABIT/633-661 GACACGCCAGAAATACTGCGTGTTAAAGAAAATCAAAAGAATTTCAGCTCGGTTTTATATAAAGAGGATGTCTCACCTGGAACAGCA
NEBU_HUMAN/6383-6411 GTTACTCCAGAGATGGAGAGAGCTAAGCGCAACCAAGAAAACATTAGCTCGGTTCTTTATTCTGATAGTTTCCGGAAACAAATACAA
NEBU_HUMAN/6259-6285 ATCACTCCAGAGATGGAGAGAGTCAAACGCAATCAAGAGAACTTTAGCTCGGTGTTATACAAAGAAAACATGGGCAAGGGA------
Q14215_HUMAN/2690-2718 GTCACTCCCGAGATGGAGCGAGTCAAACACAATCAAGAAAATATTAGCTCGGTTTTGTACAAAGAAAATGTGGGGAAAGCCACCGCA
NEBL_HUMAN/731-759 GTAACTCCTGAAATGGAAAGAGTGAAGAAGAATCAAGAAAATATTAGCTCGGTAAAATATACCCAGGACCATAAACAGATGAAAGGT
Q14215_HUMAN/1468-1496 GATACCCCTGAGATCCGCCAAGTCAAGAAGACACAAGAGGCTGTCAGTGAGTTGATCTACAAATCAGACTTCTTCAAGATGCAGGGC
O77813_RABIT/762-790 GATACTCCAGAGATGAGACGGGTGAGGGAAACCCAACGGCACATCTCAACCGTGAAATATCATGAAGACTTTGAGAAACACAAGGGT
NEBL_HUMAN/766-794 GATACACCTGCTATGAGACATGTTAAAGAAGCACAAAATCATATTTCAATGGTAAAATACCATGAAGATTTTGAAAAAACAAAGGGG
LASP1_HUMAN/103-131 GACACGCCCGAGCTCCAGAGAATCAAGAAGACCCAGGACCAGATCAGTAATATAAAATACCATGAGGAGTTTGAGAAGAGCCGCATG
NEBU_HUMAN/118-146 GATACTCCAGAACTTCGCAGAATCAAAAAAGTACAAGATCAACTCAGTGAGGTTAAGTATCGAATGGATGGTGATGTTGCTAAGACT
Q14215_HUMAN/1190-1218 GATGATCCGAACACAGCACGGTGCCTCCGAGTTGGCAAGCTTAACATCGATCGCCTGTACAGATCAGTTTATGAAAAGAACAAGATG
Q14215_HUMAN/700-728 GATGATCCTAAGCTGGTTTGGTTTGAGCATGCAGGCCAGATTCAGAATGAGAGACTATACAAAGAGGACTATCACAAAACAAAGGCC
Q14215_HUMAN/216-244 GAAGACCCTAAACTGGTTTGGGCAGCAAATGTGTTGAAGATGCAGAATGACAGGCTGTACAAAAAGGCCTACAACGACCACAAAGCC
Q62412_MOUSE/844-872 GATGATCCCAGGATCCTTTGCGCCATGCACGCAGGGAAGATTTACAGTGACAGGGAGTACAAGAAGGAATTCCAGAAATGGAAGACC
NEBU_HUMAN/3785-3813 GATGATCCCAAGATTATGTGTGCCATACATGCAGAAAAAATTCAAAGTGAAAGGGAGTACAAGAAGGAATTCCAAAAGTGGAAAACC
Q14214_HUMAN/584-612 GACGATCCAAAGATGCTGCACTCCTTGAAGACAGCCAAAAACCAGAGTGATCGCGAATATCGAAAAGATTATGAAAAGTCAAAAACT
Q14214_HUMAN/337-365 GACGATCCCAAGATGCTGCACTCCTTGAAGGTGGCCAAAAACCAGAGTGATAGATTATACAAGGAAAACTATGAGAAGACAAAGGCA
NEBU_HUMAN/3299-3327 GATGACCCCAAGATAATGTGGTCCCTCCACATTGCCAAAGTGCAGAGTGACCGTGAGTACAAGAAAGATTTTGAGAAATACAAGACA
Q14214_HUMAN/2291-2319 GATGACCCCAAGATGATGTGGTCCATGCATGTGGCCAAGATCCAGAGTGACAGGGAGTACAAGAAGGACTTTGAGAAGTGGAAGACC
Q62412_MOUSE/1087-1115 GATGACCCCAAGTTGGTATGGTCTATACATGCTGCTAAGATCCAGAGTGACAGAGAATACAAGAAAGCCTATGAGAAGTCGAAAGGC
Q14214_HUMAN/2048-2076 GATGACCCAAAACTTGTGTTGTCCATGAATGTAGCCAAAATGCAGAGTGAAAGAGAATACAAGAAGGACTTTGAGAAGTGGAAAACT
Q14214_HUMAN/1072-1100 GATGATCCCAAGCTGGTCCACTATATGAATGTGGCAAAGCTGCAGTCTGATCGTGAATACAAGAAGAACTATGAGAACACCAAAACC
Q04020_RABIT/101-129 GACGACCCCAAGTTGGTGCACTTCATGCAGGTGGCCAAGATGCAGTCAGACCGGGAATACAAGAAGGCCTATGAGAAATCCAAGACC
O35884_MOUSE/1044-1072 GATGACCTCAGCCTTGCTCATTCAGTGCACGCGACCTCGCTGCAGAGTGATGTGAATTATAAGAAAGGCTTTGAACACGCAAAGGCT
O77813_RABIT/96-124 GATGACAAAGACATGGTGCTGGCTCTCAAGAATTCTTTAATAGAAAGTGACTTGAAATACAAAGAGAAACATGTCAAGGAAAGAGGA
O77813_RABIT/168-196 GAGACCCGGGATACTGTTCACGTCAAGAAAGTGACCAAGCATGTCAGTGATACCAATTACAAAAAGAAGTTTGTCAAGGAGAAAGGG
NEBL_HUMAN/107-135 GCCACAATTGACAGTGTTTTTGCAGGAGAAGTTACACAGCTCCAGAGTGAGGTGGCCTACAAGCAGAAACATGATGCTGCCAAAGGA
Q14215_HUMAN/1291-1319 GACACTCCTGAAATCCTCCATGCCAAGCATGCTTATGATCTACGTGATGATATCAAGTATAAAGCTCACATGTTGAAAACAAGGAAT
Q14215_HUMAN/1046-1074 GATACACCCCAAATCCTCCATGCCAAGAAATCATACGACCTTCAGAGTCAGCTACAATATACAGCAGCAGGTAAAGAAAATCTACAA
Q14215_HUMAN/1783-1811 GATACCCCTGATTTCACTCTGGCTGAAAAGAACAAGACTCTCTACAGCAAGTATAAGTATAAAGAAGTATTTGAAAGGACAAAGTCA
O77813_RABIT/563-591 GACACTCCCGAGATCATTCACGCCCAGCAAGTCAAGAACCTTTCAAGCCAGAAAAAGTACAAGGAAGATGCTGAGAAGTGCATGTCA
NEBL_HUMAN/541-569 GATATCCCAGATATCCTTCGAGCCAAGAGGACATCTGAAATCTATAGCCAGAGAAAGTATAAAGATGAAGCAGAGAAGATGCTTTCT
Q14215_HUMAN/1678-1706 GATACGCCAATCCTCATCAGAGCCAAGAGGGCTTACTGGAATGCCAGTGATCTACGCTACAAAGAAACATTTCAAAAGACCAAAGGG
Q14215_HUMAN/836-864 GATCCTCCAGAGATTGTTTTAGCCAAGATTAATTCTGTCAATCAAAGTGATGTAAAATATAAAGAAACATTTAATAAAGCAAAGGGC
O35884_MOUSE/488-516 GACGCCCCTCAGCTGCTGAAGGCCAAGGCCAATGCAGAACTGTTCAGCGAGGTGAAGTACAAAGAAGGCTGGCAGAAGACAAAGGGG
O77813_RABIT/381-409 GATAATCTGGAGCAGCTTCACCTAAAAGAGGCTACAGAATTACAGAGCATAGTGAAATACAAAGAAAAGTATGAAAAGGAACGGGAA
NEBL_HUMAN/320-348 GATGCTGTGGAACATCTGCACCATAAAGGCAATGCCGTCCTCCAAAGTCAGGTGAAATATAAAGAAGAATATGAGAAAAATAAGGGA
LASP1_HUMAN/67-95 GACACCCCGGAAAACCTTCGCCTCAAGCAACAGAGTGAGCTCCAGAGTCAGGTGCGCTACAAGGAGGAGTTTGAGAAGAACAAGGGC
Q14214_HUMAN/89-117 GAGAACCCACAGCTTAGGCAGCTGAAGGCAGCAGGAGATGCCCTAAGTGACAAACTATACAAGGAAAACTATGAAAAGACAAAAGCA
Q14214_HUMAN/50-78 GAAACACCAGAGTATAAAATGAATAAAAAAGCTGGTGTGGCAGCTAGCAAGGTAAAATACAAAGAAGACTATGAAAAGAATAAAGGA
Q14215_HUMAN/907-935 CGCTACATTCCCATTGTTGGAGCCAAGCATGCTGATCTGGTGAACAGTGAGCTTAAATACAAAGAGACATATGAGAAGCAGAAAGGT
Q14215_HUMAN/662-690 GATGCTGTGCCATTTGTTCATGCCCATCACTGCAATGACGTTCAGAGTGAGCTGAAATACAAAGCTGAACATGTGAAGCAAAAAGGT
O35884_MOUSE/763-791 GACTCCTTGGCATTCCTGACAGCCAAAGCCAAGAGAGACCTGGCTAGTGAGGTGAAATACAAAGAGGACTATGAAAGGTCCAGAGGG
Q14214_HUMAN/790-818 GATGCGATTCCCATCAGAGCTGCCAAAGCTGCCAGGCAGGCGGCGAGTGACGTTCAGTACAAAAAAGACTATGAAAAGGCTAAAGGG
Q14214_HUMAN/299-327 GATGCCATTCCCCTGCTGGCAGCCAAAGCCAACACCAAGAACACCAGCGATGTGATGTACAAGAAAGACTATGAAAAAAACAAAGGG
NEBU_HUMAN/3018-3046 GACGCCATCCCCATCGTGGCTGCCAAGGCCTCCAGGGACGTTATCAGTGATTACAAATACAAAGATGGTTACCGCAAGCAGCTCGGC
Q14214_HUMAN/2010-2038 GATGCAATTTCTGTACAGCTAGCTAAAGCTTCAAGAGACATTGCTAGTGATTATAAATACAAACAAGGCTACCGAAAGCAACTTGGC
Q14214_HUMAN/2253-2281 GATGCCATACCAATCAAAGCAGCAAAAGCCTCCCGGGAAATTGCCAGTGAATACAAGTACAAGGAAGGCTTTCGCAAGCAGCTCGGC
Q14215_HUMAN/420-448 GATGCCATCCCCATCCAGGCTGCCAAGGCCTCCAGGGAGATTGCCAGTGACTATAAATATAAGCTTGACCATGAGAAGCAGAAGGGA
Q61953_MOUSE/43-71 GATGCCATTCCCATCGTTGCTGCCAAAAGTTCAAGGAACATCGCTAGTGACTGCAAATACAAGGAGGCCTATGAGAAAGCCAGAGGC
Q14214_HUMAN/1034-1062 GATGCTATTCCCATCACTGCAGCCAAGGCATCGAGAAACATTGCCAGTGATTATAAATACAAGGAAGCTTATGAGAAGTCAAAGGGA
Q14215_HUMAN/178-206 GATGCCATTGGGATCCAGCATGCCAAGGCTTCCAGGGATATTGCCAGTGACTATCTGTACAAAACTGCTTATGAGAAACAGAAAGGC
Q04020_RABIT/63-91 GATGCCATCTCCATAAAGGCTGCCAAAGCTTCTAGAGACATTGCCAGTGATTACAAATACAAGCAAGCGTATGAGCAAGCCAAAGGA
O35884_MOUSE/524-552 GACGCCATGTCTCTGTTGGCCGCCAAAGCCTCGGGGGAGCTTGCTAGCAGCGTTAAATACAAAGAAGAATATGAGAAAATGAAGGGC
O15500_HUMAN/43-71 GATGCCCTTCCATTCCAAGCAGCAAAGGCTTCTGGTGAAATCATAAGTGATTACAAATACAAAGAGGCATTTGAGAAAATGAAAGGA
Q14215_HUMAN/1924-1952 GACACACCCATGTTGCTGCATGTCCGCAAGGTTAAAGATGAAGTCAGTGATCTGAAATACAAAGAAGTATACCAAAGAAATAAATCC
Q14215_HUMAN/1748-1776 GATCGTCCAGAGCATTTCCACCACCGAGCAGTCACTGACACAGTCAGTGATGTAAAATATAAAGAAGACTTGACTTGGCTTAAAGGC
Q14215_HUMAN/1888-1916 GATACTCCAGAACACCTGCGTACTACAAAAGTCAACAAACAAATCAGCGATATCCTTTATAAATTGGAATACAACAAGGCCAAACCC
Q14215_HUMAN/1853-1881 GATGAGCCTAGACATCTGCTGGCTAAGACCGCAGGCGACCAGATCAGTCAGATCAAATACAGGAAAAACTATGAAAAATCAAAGGAC
Q14215_HUMAN/1011-1038 GAAGAACCCAATGTTATACGCGTCCGAAACGCCCAGGAGATCTTGAGTGATAATGTGTATAAAGATGACCTGAAT---TGGTTGAAA
Q14214_HUMAN/1870-1898 GATGCAATGAACATTGAGCTGACCAGGAATATGAATCGCATACAGAGTGATAATGAATATAAGCAAGATTACAATGAATGGTACAAA
Q14214_HUMAN/1626-1654 GATGCCATGAGCTTTGAATTGGCCAAAAATATGATGCAGATTCAAAGTGATAATCAGTACAAGGCTGACTATGCTGACTTCATGAAG
Q14214_HUMAN/894-922 GACGCCATGGACCTGGAGCTGTCTAAGAACATGATGCAGATACAGAGTGATAACGTCTACAAGGAAGACTACAACAACTGGATGAAA
Q14214_HUMAN/1382-1410 GATGCCTTGAATGTGGAGCACTCCAGGAATGCCATGCAGATTCAGAGTGATAATCTGTACAAATCTGACTTCACCAATTGGATGAAA
Q62412_MOUSE/910-937 GACCAGAACGACATTATTCAAGCAAAGAAGGCCTACGAACTGCAGAGTGATAGTGTGTATAAAGCAGATCTGGAG---TGGCTGCGT
Q14214_HUMAN/2114-2141 GATCAGAACGATGTTGTGCAAGCTAAGAAAGTTTATGAACTGCAAAGTGAGAATCTATATAAATCTGACCTTGAG---TGGCTGAGA
Q62412_MOUSE/424-451 GACCAGAATGATGTCATCCAGGCCCGGAAAGCATATGACCTCCAGAGTGATAATCTGTACAAGGCAGACCTGGAA---TGGATGAAA
Q14214_HUMAN/650-678 GATAGCATCAATGTGGACCTTGCCAAGAAGGCATATGCGCTGCAGAGCGATGTTGAATACAAAGCTGACTACAATAGCTGGATGAAA
O77813_RABIT/61-88 GACCGACCGGACTTCATCCAGGCTGCCAAGTCATCCCTGCAGCAAAGCGATTTTGAATATAAGCTCGACCGGGAG---TTCCTCAAG
Q90684_CHICK/16-44 GATACGCCAGATTTGATTAGAGTTAAAAATGCGGCTCAGATACTAAATGAGAAACAATACAAGAAAGACCTGGAAACTGAAATTAAA
O77813_RABIT/490-518 GATACACCTGACATGCTGAGAGCAAAGAATGCCACCCAGATCCTCAATGAGAAAGAATATAAGAGAGACCTGGAGCTGGAAGTCAAA
Q90684_CHICK/90-118 GATACCCCTGATATACAACGAGCAAAGAAAGCTTCTGAAATTGTAAGCCAGAAAGAATATAGAAAAGATCTGGAGACTGAAATTATA
Q90684_CHICK/53-81 GATACTCCTGAGATAAGACGAGCCAAGAAAGCTTCTGAAATTGCAAGCACTAAAGACTATAAGAAAGACTTGGAGAATGAAATTAAA
NEBL_HUMAN/504-532 GACACTCTTGATGTCCAGAGAGCTAAGAAAGCATCCGAGATGGCCAGCCAGAAACAATACAAGAAGGACTTAGAAAATGAAATTAAA
NEBL_HUMAN/467-495 GACACCCTTGAAATGCAGCATGCCAAGAAGGCTGCAGAGATAGCGAGTGAGAAAGACTATAAAAGAGATCTGGAGACTGAAATTAAA
NEBU_HUMAN/258-286 GATCCTCCAGATATAGAATTTGCCAAGAAAGTAACCAATCAAGTGAGCAAGCAAAAATACAAAGAAGACTATGAAAATAAAATCAAA
O77813_RABIT/416-444 GAAACACCAACATACATCACTGCCAAGGAGTCTCAGCAGATGCAGAGTGGGAAAGAATATAGGAAAGAGTATGAAGAGTCCATTAAA
NEBL_HUMAN/356-384 GAGACACCATCATATCAAGCTTCAAAGGAGGCTCAAAAGATGCAAAGTGAAAAAGTTTACAAAGAGGATTTTGAGAAGGAGATTAAA
Q14215_HUMAN/1116-1144 GAAACAGTGGATTATGACAGAACCAGAAACCTGAAGAATCTTTACAGCAGTAACCTGTACAAGGAGGCCTGGGATAGAGTGAAAGCC
Q14215_HUMAN/871-899 GATACACCACATATCTCCCACTCCAAAGACATGGGAAAACTCTACAGTACTATACTGTATAAAGGGGCGTGGGAGGGCACCAAGGCC
Q14215_HUMAN/626-654 GAAACCCCCCTGCTGCACACTGCCCAGGAGGCTGATAGGATACTGGACCAGTATCTCTACAAGGAAGGCTGGGAGAGACAAAAAGCC
O77813_RABIT/528-556 GAAACTCCAGATTTTATGAGGGCCAGGAATGCTACTGATATTGCCAGCCAGATTAAATACAAGCAATCAGCAGAAATGGAAAAAGCC
Q14215_HUMAN/1573-1601 GACACTCCAGAATACAGAAAAGTGCAAGAACTGAAGACACATCTGAGTGAGCTGGTCTACAGAGCTGCAGGCAAGAAGCAGAAGTCA
O77813_RABIT/239-267 GATCGGCCAGACATCAAGAAGGCCACACAGGCAGCCAAACAGGCCAGCGAGGTGGAGTACAGAGCCAAGTACCGCAAGGAAGGCAGC
Q14215_HUMAN/1225-1252 GACATGGTAGAGATGGTTACTGCCAAGGATTCCCAGAAGAAAGTCAGTGAGATTGATTACCGCCTGCGCCTC---CACGAATGGATT
Q14215_HUMAN/1326-1354 GATACACCAGTCTACGTGCAGGCTGTCAAAAGTGGGAAACAGCTAAGTGACGCTGTCTACCACTATGACTATGTGCACAGTGTCAGA
Q14215_HUMAN/1081-1108 GACACGCCCCTCTATGTGACTGCTGTTCAGAGTGGCATTAATGCCAGTGAGGTAAAATATAAAGAAAATTAT---CATCAGATTAAG
Q14215_HUMAN/592-619 GACAGAGTTGATTATGTGACAGCGAAACAAAGTGGCGAGATCCTCGATGATATTAAATACCGGAAAGACTGG---AATGCCACCAAA