EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF00818 alignment
(110 sequences with 48 bp)


ICEV_PSESX/669-684 GGTTATGGCAGCACCCAGACCGCGAGTTACAAAAGCATGCTGACCGCC
ICEN_PSESY/673-688 GGTTATGGCAGCACCCAGACCGCGAGTTACAGAAGCATGCTGACCGCC
ICEK_PSESX/621-636 GGTTATGGCAGCACCCAGACCGCGAGTTACAGAAGCATGCTGACCGCC
ICEA_PANAN/707-722 GGCTACGGCAGCACCCAGACCGCCAGCTATCACAGTAGCCTGACGGCG
ICEN_ERWHE/595-610 GGTTACGGCAGCACCCAGACCGCCAGTTATCACAGTAGCCTGACGGCG
ICEN_ERWHE/739-754 GGCTACGGCAGCACCCAGACCGCCAGCTATCACAGTAGCCTGACGGCG
ICEN_XANCT/1245-1260 GGCTACGGTAGCACCCAGATCGCTGGATACGAGAGCACCTTGACCGCG
ICEN_XANCT/541-556 GGCTATGGCAGCACCCAGACCGCCGGCTACGATAGCACCCTGACCGCC
ICEN_PSESY/913-928 GGTTATGGCAGTACGCAGACAGCCGGCTATAAAAGTACCCTCACGGCC
ICEN_XANCT/1213-1228 GGCTATGGCAGTACCCAAACCGCCGGCTACAAAAGCACGCTGACCGCG
ICEK_PSESX/861-876 GGTTATGGCAGTACGCAGACAGCCGGCTATAAAAGTACCCTCACGGCC
ICEV_PSESX/909-924 GGTTATGGCAGTACGCAGACCGCAGGCTATAAAAGCACCCTCACTGCC
ICEN_PSEFL/774-789 GGTTACGGCAGCACCCAGACAGCAGGATATGAATCTACGCTAACTGCA
ICEN_PSESY/769-784 GGCTATGGCAGCACGCAGACGGCAGGCTACGAAAGCACGTTGACCGCC
ICEN_PSESY/817-832 GGTTACGGCAGTACGCAAACGGCAGGCTACGAGAGCACGTTGACCGCC
ICEN_PSESY/865-880 GGTTATGGCAGCACGCAGACTGCGGGTTATGAGAGCACGTTGACCGCC
ICEK_PSESX/717-732 GGCTATGGCAGCACGCAGACGGCAGGCTACGAAAGCACGTTGACCGCC
ICEK_PSESX/765-780 GGTTACGGCAGTACGCAAACGGCAGGCTACGAGAGCACGTTGACCGCC
ICEK_PSESX/813-828 GGTTATGGCAGCACGCAGACTGCGGGTTATGAGAGCACGTTGACCGCC
ICEV_PSESX/813-828 GGTTACGGCAGTACACAGACGGCAGGCTACGAGAGTACGTTGACCGCC
ICEV_PSESX/861-876 GGTTATGGCAGTACGCAGACTGCGGGTTACGAGAGCACCTTGACCGCC
ICEA_PANAN/1043-1058 GGTTACGGTAGTACCCAGACGGCGGGTTATCAAAGTACGCTGACAGCC
ICEN_ERWHE/979-994 GGTTACGGTAGTACCCAGACGGCGGGTTATCAAAGTACGCTGACAGCC
ICEN_PANAN/755-770 GGTTACGGTAGTACCCAGACGGCGGGTTATCAAAGTACGCTGACAGCC
ICEA_PANAN/499-514 GGCTATGGCAGTACCCAGACAGCGGGTTACGGTAGCACGCTGACAGCG
ICEN_ERWHE/499-514 GGCTATGGCAGTACCCAGACAGCGGGTTACGGTAGCACGCTGACAGCG
ICEN_PANAN/499-514 GGCTATGGCAGTACCCAGACAGCGGGTTACGGTAGCACGCTGACAGCG
ICEN_PSEFL/678-693 GGCTACGGCAGCACCCAGACTGCAGGACACGAGAGTACACTCACTGCT
ICEN_XANCT/1117-1132 GGCTATGGCAGCACCCAGACCGCCGGCTACGACAGCAACCTCACTGCC
ICEN_PSEFL/870-885 GGTTATGGAAGCACCCAGACCGCAGGTTACGACAGTATCCTGACCGCA
ICEN_PSEFL/822-837 GGATATGGCAGTACTCAAACCGCAGGCTACAAAAGCATTCTAACCGCA
ICEA_PANAN/803-818 GGCTACGGCAGCACGCAGACAGCGGGTTATCACAGTATTCTGACGGCC
ICEA_PANAN/899-914 GGCTACGGCAGCACGCAGACCGCCGGTTATCACAGTATTCTGACGGCC
ICEN_ERWHE/787-802 GGCTACGGCAGCACGCAGACAGCGGGTTATCACAGTATTCTGACGGCC
ICEN_PANAN/611-626 GGCTACGGCAGCACGCAGACCGCCGGTTATCACAGTATTCTGACGGCC
ICEA_PANAN/611-626 GGCTATGGCAGCACGCAGACCGCCGGTTACAACAGTATTCTGACGGCC
ICEA_PANAN/659-674 GGCTATGGCAGCACGCAGACCGCCGGTTACAACAGTATTCTGACGGCC
ICEA_PANAN/755-770 GGCTACGGCAGCACGCAGACAGCGGGTTATAACAGTATTCTGACGGCC
ICEA_PANAN/851-866 GGCTATGGCAGTACGCAGACAGCGGGTTACAACAGCATTCTGACGGCC
ICEA_PANAN/947-962 GGCTACGGCAGCACGCAGACCGCCGGTTACAACAGTATTCTGACGGCC
ICEN_ERWHE/643-658 GGCTACGGCAGCACGCAGACCGCCGGTTACAACAGTATTCTGACGGCC
ICEN_ERWHE/691-706 GGCTACGGCAGCACGCAGACAGCGGGTTACAACAGCATCCTGACGGCC
ICEN_ERWHE/835-850 GGCTACGGCAGCACGCAGACAGCGGGTTACAACAGCATCCTGACGGCC
ICEN_ERWHE/883-898 GGCTACGGCAGCACGCAGACAGCGGGTTACAACAGCATCCTGACGGCC
ICEN_PANAN/659-674 GGCTACGGCAGCACGCAGACCGCCGGTTACAACAGTATTCTGACGGCC
ICEN_PSESY/721-736 GGCTATGGAAGCACTCAGACGGCGGGCTTCAAAAGCATACTGACCGCC
ICEK_PSESX/669-684 GGCTATGGAAGCACTCAGACGGCGGGCTTCAAAAGCATACTGACCGCC
ICEN_PSESY/625-640 GGTTATGGAAGTACACAGACAGCGGGCCACAAAAGTATCCTGACCGCT
ICEK_PSESX/573-588 GGTTATGGAAGTACACAGACAGCGGGCCACAAAAGTATCCTGACCGCT
ICEV_PSESX/621-636 GGTTATGGGAGCACACAGACAGCCGGCCACAAAAGTATCCTGACCGCT
ICEN_PSEFL/630-645 GGTTACGGCAGTACTCAAACTGCCGGTCACGGAAGCATCCTGACTGCC
ICEK_PSESX/685-700 GGTTACGGCAGTACCCAGACGGCACAGGAGCGCAGCGACCTGGTCGCA
ICEV_PSESX/733-748 GGTTATGGCAGTACACAGACGGCACAGGAGCGCAGCGACCTGGTCGCA
ICEN_PSESY/641-656 GGTTATGGCAGTACTCAGACGGCCAGGGACGGTAGCGACCTGATTGCG
ICEA_PANAN/675-690 GGTTATGGCAGCACCCAGACGGCGCAGGAGGGCAGCGATCTCACCGCA
ICEN_ERWHE/659-674 GGTTACGGCAGCACCCAGACGGCGCAGGAGGGCAGCGATCTCACCGCA
ICEA_PANAN/291-306 GGTTACGGCAGTACCCAGACCGCGCAGAAGGGCAGCGATCTTACGGCC
ICEA_PANAN/339-354 GGTTATGGCAGCACCCAGACCGCGCAGAAGGGCAGCGACCTTACGGCC
ICEA_PANAN/387-402 GGTTACGGCAGTACCCAGACCGCGCAGAAGGGCAGCGATCTCACTGCA
ICEA_PANAN/435-450 GGTTATGGCAGCACCCAGACCGCGCAGAAGGGCAGCGACCTTACGGCC
ICEA_PANAN/467-482 GGTTACGGCAGTACCCAGACCGCGCAGAAGGGCAGCGATCTTACGGCC
ICEN_ERWHE/275-290 GGTTACGGCAGCACGCAGACCGCGCAGAAGGGCAGCGATCTTACCGCG
ICEN_ERWHE/323-338 GGTTATGGCAGCACCCAGACCGCGCAGAAGGGCAGCGACCTTACGGCC
ICEN_ERWHE/371-386 GGTTACGGCAGTACCCAGACCGCGCAGAAGGGCAGCGATCTTACCGCG
ICEN_ERWHE/419-434 GGTTATGGCAGCACCCAGACCGCGCAGAAGGGCAGCGACCTTACGGCC
ICEN_ERWHE/467-482 GGTTACGGCAGTACCCAGACCGCGCAGAAGGGCAGCGATCTTACGGCC
ICEN_PANAN/275-290 GGTTACGGCAGCACGCAGACCGCGCAGAAGGGCAGCGATCTTACCGCC
ICEN_PANAN/323-338 GGTTATGGCAGCACCCAGACCGCGCAGAAGGGCAGCGACCTTACGGCC
ICEN_PANAN/371-386 GGTTACGGCAGCACGCAGACCGCGCAGAAGGGCAGCGATCTTACCGCG
ICEN_PANAN/419-434 GGTTACGGCAGCACCCAGACCGCGCAGAAGGGCAGCGACCTTACGGCC
ICEN_PANAN/467-482 GGTTACGGCAGTACCCAGACCGCCCAGAAGGGCAGCGATCTTACTGCA
ICEA_PANAN/627-642 GGTTATGGCAGCACCCAGACGGCGGAGGAGGGCAGCGATCTCACCGCA
ICEA_PANAN/563-578 GGCTACGGCAGTACCCAGACGGCGAGAGAAGGCAGTGACCTCACTGCC
ICEN_ERWHE/563-578 GGCTACGGCAGTACCCAGACGGCGAGAGAGGGCAGTGACCTCACTGCC
ICEN_PANAN/563-578 GGCTACGGCAGTACCCAGACGGCGAGAGAGGGCAGTGACCTCACTGCC
ICEK_PSESX/221-236 GGCTACGGCAGTACCCAGACTTCCGGAGAAGACAGCTCGCTCACAGCG
ICEV_PSESX/269-284 GGTTACGGCAGTACTCAGACTTCCGGAGAAGACAGCTCGCTCACAGCA
ICEN_XANCT/1133-1148 GGTTACGGCAGCACGCAGACGGCGCGCGAGGACAGCTCGCTCACTGCT
ICEA_PANAN/275-290 GGTTACGGCAGTACCCAGACCGCGGGCGAAGACAGCTCGCTGACAGCC
ICEA_PANAN/371-386 GGTTACGGCAGTACCCAGACGGCGGGCGAAGACAGCTCGCTGACAGCC
ICEN_ERWHE/259-274 GGTTACGGCAGTACCCAGACGGCGGGCGAAGACAGCTCGCTGACAGCC
ICEN_ERWHE/355-370 GGTTACGGCAGTACCCAGACGGCGGGAGAAGACAGCTCGCTGACAGCC
ICEN_ERWHE/451-466 GGTTACGGCAGTACACAGACGGCGGGCGAAGACAGCTCGCTGACAGCC
ICEN_PANAN/259-274 GGTTACGGCAGTACCCAGACGGCGGGCGAAGACAGCTCGCTGACAGCC
ICEN_PANAN/355-370 GGTTACGGCAGTACCCAGACGGCGGGCGAAGACAGCTCGCTGACAGCC
ICEN_PANAN/451-466 GGTTACGGCAGTACCCAGACGGCGGGCGAAGACAGCTCGCTGACAGCC
ICEA_PANAN/259-274 GGTTACGGCAGTACCCAGACGGCGGGCGAAGACAACTCGCTGACAGCC
ICEN_PSEFL/838-853 GGCTACGGGAGCACTCAGACCGCCCAGGAAGAGAGTTCGCTTACGGCC
ICEN_PSEFL/694-709 GGCTACGGCAGCACCCAAACAGCTCAGGAGGATAGTTCACTTACTGCG
ICEN_PSEFL/646-661 GGATACGGCAGTACGCAGACGGCACAGGAAGGAAGTTCACTCACCGCA
ICEN_XANCT/589-604 GGCTACGGCAGTACGCAGACCGCTGGCAGCGACAGTTCGCTGACGGCC
ICEN_XANCT/877-892 GGCTACGGCAGCACGCAAACGGCCGGCAGCGACAGTTCGCTGACCGCC
ICEN_XANCT/1021-1036 GGCTACGGCAGCACGCAAACGGCCGGCAGCGACAGTTCGCTGACCGCC
ICEN_XANCT/1069-1084 GGCTACGGCAGCACGCAAACGGCCGGCAGCGACAGTTCGCTGACCGCC
ICEN_XANCT/301-316 GGCTACGGCAGCACGCAAACGGCCGGTAGCGAGAGTTCCTTGACCGCT
ICEN_XANCT/349-364 GGCTACGGCAGCACCCAGACCGCCGGCAGCGAGAGTTCCTTGACCGCC
ICEN_XANCT/493-508 GGCTACGGCAGCACGCAGACCGCTGGCAGCGAAAGTTCGCTGACGGCC
ICEN_XANCT/525-540 GGCTACGGCAGTACCTCGACGGCGGGTCACGACAGTTCGCTGATCGCC
ICEN_XANCT/1149-1164 GGCTACGGCAGCACGTCCACCGCCGGTCATGACAGTTCGCTGATCGCC
ICEN_PSEFL/758-773 GGCTACGGCAGTACATCGACTGCGGGTTATCAAAGCTCGTTAATTGCG
ICEA_PANAN/883-898 GGCTACGGCAGCACCTCGACGGCAGGCTACGACAGCTCGCTAATCGCG
ICEN_ERWHE/867-882 GGCTACGGCAGTACCTCGACGGCGGGTTACGACAGCTCGTTAATCGCG
ICEN_PANAN/595-610 GGCTACGGCAGTACCTCGACGGCGGGTTACGACAGTTCGTTGATTGCA
ICEA_PANAN/483-498 GGTTATGGCAGTACCTCTACGGCAGGCTATGAAAGTTCATTGATCGCG
ICEA_PANAN/979-994 GGCTACGGCAGTACTTCTACGGCAGGTTATGAGAGTTCACTGATCGCA
ICEN_ERWHE/483-498 GGTTATGGTAGTACCTCTACGGCAGGCTATGAAAGTTCATTGATCGCG
ICEN_ERWHE/915-930 GGCTACGGCAGTACTTCTACGGCAGGTTATGAGAGTTCACTGATCGCA
ICEN_PANAN/483-498 GGTTATGGCAGTACCTCTACGGCAGGCTATGAAAGTTCATTGATCGCG
ICEN_PANAN/691-706 GGCTACGGCAGTACTTCTACGGCAGGTTATGAGAGTTCACTGATCGCA
ICEN_XANCT/221-236 GGCTACGGCAGTACCGAAACCGCAGGCGATCACAGCGATCTGATCGCC