EMBL-EBI > Goldman Group

PANDIT Home | Browse PANDIT | Help on PANDIT | Release notes | Pfam



PANDIT Homepage
pan•dit
PANDIT
Protein and Associated NucleotideDomains with Inferred Trees

PF00600 alignment
(2 sequences with 651 bp)


VNS1_IATKB/1-217 ATGGATTCCAACACGATAACCTCGTTTCAGGTAGATTGTTATCTATGGCACATAAGAAAGCTGCTCAGTATGAGAGACATGTGTGATGCTCCCTTTGATGACAGGCTCCGAAGAGACCAAAAGGCATTAAAGGGAAGAGGCAGCACACTTGGGCTCGATCTAAGAGTGGCTACAATGGAAGGGAAAAAGATCGTTGAGGACATTCTGAAGAGTGAAACAGACGAAAACCTCAAAATAGCCATTGCGTCCAGTCCTGCTCCTAGGTATATTACTGATATGAGCATAGAGGAGATAAGCCGAGAATGGTATATGCTGATGCCTAGGCAGAAAATAACCGGAGGCCTAATGGTGAAAATGGACCAAGCCATAATGGATAAGAGAATCATCCTTAAAGCAAATTTCTCAGTTCTATTTGACCAACTAGAGACATTAGTCTCTCTGAGGGCATTCACAGAAGATGGTGCTATTGTGGCTGAAATATCTCCCATTCCCTCCATGCCAGGACATTCTACAGAGGATGTCAAAAATGCAATTGGAATCCTCATCGGCGGACTTGAATGGAATGATAACTCAATTCGAGCGTCTGAAAATATACAGAGATTCGCTTGGGGAATCCGTGATGAGAATGGGAGACCTCCACTCCCTCCAAAA
VNS1_IAMAN/1-217 ATGGATTCCAACACTGTGTCAAGCTTTCAGGTAGACTGCTTTCTTTGGCATGTCCGCAAACGATTTGCAGACCAAGAACTGGGTGATGCCCCATTCCTTGACCGGCTTCGCCGAGATCAGAAATCTCTAAGAGGAAGAGGCAGCACTCTTGGTCTGGACATCGAAACAGCCACTCGTGCTGGAAAGCAGATAGTGGAGCGGATTCTGGAGGAAGAATCCGATGAGGCACTCAAAATGACTATTGCCTCTGTACCTGCTTCACGCTACCTAACTGACATGACTCTTGAGGAGATGTCAAGAGACTGGTTCATGCTCATGCCAAAGCAAAAAGTAGCAGGCTCCCTCTGTATCAGAATGGACCAGGCGATCATGGATAAGAACATCATACTGAAAGCGAACTTCAGTGTGATCTTCGATCGGCTGGAGACACTAATACTGCTCAGGGCTTTCACCGAAGAAGGAGCAATTGTCGGCGAAATTTCACCATTGCCTTCTCTTCCAGGACATACTGATGAGGATGTCAAAAATGCAATTGGGGTCCTCATCGGAGGACTTGAATGGAATGATAACACAGTTCGAGTCTCTGAAACTCTACAGAGATTCGCTTGGAGAAGCAGTAATGAGGATGGGAGACCTCCACTCCCTCCAAAG