spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 9 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
fru-miR-29b miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCAGUGU
Gasterosteus aculeatus
 
mmu-miR-29a* miR-29* Mus musculus
ACUGAUUUCUUUUGGUGUUCAG
Mus musculus
 
fru-miR-29b miR-29 Takifugu rubripes
UAGCACCAUUUGAAAUCAGUGU
Oryzias latipes
dre-miR-29b miR-29 Danio rerio
UAGCACCAUUUGAAAUCAGUGU
Danio rerio
xtr-miR-29c miR-29 Xenopus tropicalis
UAGCACCAUUUGAAAUCGGU
Xenopus tropicalis
bta-miR-29a miR-29 Bos taurus
CUAGCACCAUCUGAAAUCGGUUA
Ornithorhynchus anatinus
 
mmu-miR-30c-2* miR-30* Mus musculus
CUGGGAGAAGGCUGUUUACUCU
Mus musculus
 
bta-miR-30d miR-30 Bos taurus
UGUAAACAUCCCCGACUGGAAGCU
Canis familiaris
fru-miR-30c miR-30 Takifugu rubripes
UGUAAACAUCCUACACUCUCGG
Gasterosteus aculeatus
bta-miR-30a-5p miR-30 Bos taurus
UGUAAACAUCCUCGACUGGAAGCU
Bos taurus
ptr-miR-30a-3p miR-30 Pan troglodytes
CUUUCAGUCGGAUGUUUGCAGC
Pan troglodytes
 
hsa-miR-30c-2* miR-30* Homo sapiens
CUGGGAGAAGGCUGUUUACUCU
Homo sapiens
 
gga-miR-30d miR-30 Gallus gallus
UGUAAACAUCCCCGACUGGAAG
Gallus gallus
mmu-miR-30b miR-30 Mus musculus
UGUAAACAUCCUACACUCAGCU
Mus musculus
fru-miR-30c miR-30 Takifugu rubripes
UGUAAACAUCCUACACUCUCGG
Oryzias latipes
dre-miR-30b miR-30 Danio rerio
UGUAAACAUCCUACACUCAGCU
Danio rerio
hsa-miR-30b miR-30 Homo sapiens
UGUAAACAUCCUACACUCAGCU
Homo sapiens
 
rno-miR-30a* miR-30* Rattus norvegicus
CUUUCAGUCGGAUGUUUGCAGC
Rattus norvegicus
 
bta-miR-30c miR-30 Bos taurus
UGUAAACAUCCUACACUCUCAGC
Bos taurus
ptr-miR-30b miR-30 Pan troglodytes
UGUAAACAUCCUACACUCAGC
Pan troglodytes
 
hsa-miR-30e* miR-30* Homo sapiens
CUUUCAGUCGGAUGUUUACAGC
Homo sapiens
 
bta-miR-30a-5p miR-30 Bos taurus
UGUAAACAUCCUCGACUGGAAGCU
Ornithorhynchus anatinus
mmu-miR-30d miR-30 Mus musculus
UGUAAACAUCCCCGACUGGAAG
Mus musculus
tni-miR-30b miR-30 Tetraodon nigroviridis
UGUAAACAUCCUACACUCAGCU
Tetraodon nigroviridis
dre-miR-30d miR-30 Danio rerio
UGUAAACAUCCCCGACUGGAAG
Danio rerio
hsa-miR-30d miR-30 Homo sapiens
UGUAAACAUCCCCGACUGGAAG
Homo sapiens
 
rno-miR-30c-2* miR-30* Rattus norvegicus
CUGGGAGAAGGCUGUUUACUCU
Rattus norvegicus
 
xtr-miR-30a-5p miR-30 Xenopus tropicalis
UGUAAACAUCCUCGACUGGAAG
Xenopus tropicalis
bta-miR-30e-5p miR-30 Bos taurus
UGUAAACAUCCUUGACUGGAAGCU
Bos taurus
rno-miR-30b-3p miR-30 Rattus norvegicus
CUGGGAUGUGGAUGUUUACGUC
Rattus norvegicus
ptr-miR-30d miR-30 Pan troglodytes
UGUAAACAUCCCCGACUGGAAG
Pan troglodytes
fru-miR-30c miR-30 Takifugu rubripes
UGUAAACAUCCUACACUCUCGG
Takifugu rubripes
bta-miR-30c miR-30 Bos taurus
UGUAAACAUCCUACACUCUCAGC
Ornithorhynchus anatinus
 
mmu-miR-30a* miR-30* Mus musculus
CUUUCAGUCGGAUGUUUGCAGC
Mus musculus
 
bta-miR-30a-5p miR-30 Bos taurus
UGUAAACAUCCUCGACUGGAAGCU
Canis familiaris
tni-miR-30d miR-30 Tetraodon nigroviridis
UGUAAACAUCCCCGACUGGAAG
Tetraodon nigroviridis
 
dre-miR-30e* miR-30* Danio rerio
CUUUCAGUCGGAUGUUUGCAGC
Danio rerio
hsa-miR-30a* miR-30* Homo sapiens
CUUUCAGUCGGAUGUUUGCAGC
Homo sapiens
rno-miR-30e* miR-30* Rattus norvegicus
CUUUCAGUCGGAUGUUUACAGC
Rattus norvegicus
 
xtr-miR-30c miR-30 Xenopus tropicalis
UGUAAACAUCCUACACUCUCAGC
Xenopus tropicalis
gga-miR-30a-5p miR-30 Gallus gallus
UGUAAACAUCCUCGACUGGAAG
Gallus gallus
rno-miR-30c miR-30 Rattus norvegicus
UGUAAACAUCCUACACUCUCAGC
Rattus norvegicus
mml-miR-30a-5p miR-30 Macaca mulatta
UGUAAACAUCCUCGACUGGAAG
Macaca mulatta
mdo-miR-30a miR-30 Monodelphis domestica
UGUAAACAUCCUCGACUGGAAG
Monodelphis domestica
bta-miR-30e-5p miR-30 Bos taurus
UGUAAACAUCCUUGACUGGAAGCU
Ornithorhynchus anatinus
 
mmu-miR-30c-1* miR-30* Mus musculus
CUGGGAGAGGGUUGUUUACUCC
Mus musculus
 
bta-miR-30c miR-30 Bos taurus
UGUAAACAUCCUACACUCUCAGC
Canis familiaris
fru-miR-30b miR-30 Takifugu rubripes
UGUAAACAUCCUACACUCAGCU
Gasterosteus aculeatus
 
hsa-miR-30c-1* miR-30* Homo sapiens
CUGGGAGAGGGUUGUUUACUCC
Homo sapiens
 
xtr-miR-30e miR-30 Xenopus tropicalis
UGUAAACAUCCUUGACUGGA
Xenopus tropicalis
gga-miR-30c miR-30 Gallus gallus
UGUAAACAUCCUACACUCUCAGCU
Gallus gallus
mmu-miR-30a miR-30 Mus musculus
UGUAAACAUCCUCGACUGGAAG
Mus musculus
fru-miR-30b miR-30 Takifugu rubripes
UGUAAACAUCCUACACUCAGCU
Oryzias latipes
dre-miR-30a miR-30 Danio rerio
UGUAAACAUUCCCGACUGGAAG
Danio rerio
hsa-miR-30a miR-30 Homo sapiens
UGUAAACAUCCUCGACUGGAAG
Homo sapiens
rno-miR-30e miR-30 Rattus norvegicus
UGUAAACAUCCUUGACUGGAAG
Rattus norvegicus
 
mmu-miR-30e* miR-30* Mus musculus
CUUUCAGUCGGAUGUUUACAGC
Mus musculus
 
bta-miR-30e-5p miR-30 Bos taurus
UGUAAACAUCCUUGACUGGAAGCU
Canis familiaris
fru-miR-30d miR-30 Takifugu rubripes
UGUAAACAUCCCCGACUGGAAG
Gasterosteus aculeatus
bta-miR-30b miR-30 Bos taurus
UGUAAACAUCCUACACUCAGCU
Bos taurus
ptr-miR-30a-5p miR-30 Pan troglodytes
UGUAAACAUCCUCGACUGGAAG
Pan troglodytes
 
hsa-miR-30d* miR-30* Homo sapiens
CUUUCAGUCAGAUGUUUGCUGC
Homo sapiens
 
gga-miR-30e miR-30 Gallus gallus
UGUAAACAUCCUUGACUGG
Gallus gallus
mmu-miR-30c miR-30 Mus musculus
UGUAAACAUCCUACACUCUCAGC
Mus musculus
fru-miR-30d miR-30 Takifugu rubripes
UGUAAACAUCCCCGACUGGAAG
Oryzias latipes
dre-miR-30c miR-30 Danio rerio
UGUAAACAUCCUACACUCUCAG
Danio rerio
hsa-miR-30c miR-30 Homo sapiens
UGUAAACAUCCUACACUCUCAGC
Homo sapiens
 
rno-miR-30c-1* miR-30* Rattus norvegicus
CUGGGAGAGGGUUGUUUACUCC
Rattus norvegicus
 
xtr-miR-30a-3p miR-30 Xenopus tropicalis
CUUUCAGUCAGAUGUUUGCAGC
Xenopus tropicalis
bta-miR-30d miR-30 Bos taurus
UGUAAACAUCCCCGACUGGAAGCU
Bos taurus
rno-miR-30a miR-30 Rattus norvegicus
UGUAAACAUCCUCGACUGGAAG
Rattus norvegicus
ptr-miR-30c miR-30 Pan troglodytes
UGUAAACAUCCUACACUCUCAGC
Pan troglodytes
fru-miR-30b miR-30 Takifugu rubripes
UGUAAACAUCCUACACUCAGCU
Takifugu rubripes
bta-miR-30b miR-30 Bos taurus
UGUAAACAUCCUACACUCAGCU
Ornithorhynchus anatinus
mmu-miR-30e miR-30 Mus musculus
UGUAAACAUCCUUGACUGGAAG
Mus musculus
tni-miR-30c miR-30 Tetraodon nigroviridis
UGUAAACAUCCUACACUCUCGG
Tetraodon nigroviridis
dre-miR-30e miR-30 Danio rerio
UGUAAACAUCCUUGACUGGAAG
Danio rerio
hsa-miR-30e miR-30 Homo sapiens
UGUAAACAUCCUUGACUGGAAG
Homo sapiens
 
rno-miR-30d* miR-30* Rattus norvegicus
CUUUCAGUCAGAUGUUUGCUGC
Rattus norvegicus
 
xtr-miR-30b miR-30 Xenopus tropicalis
UGUAAACAUCCUACACUCAGCU
Xenopus tropicalis
gga-miR-30a-3p miR-30 Gallus gallus
CUUUCAGUCGGAUGUUUGCAGC
Gallus gallus
rno-miR-30b-5p miR-30 Rattus norvegicus
UGUAAACAUCCUACACUCAGCU
Rattus norvegicus
fru-miR-30d miR-30 Takifugu rubripes
UGUAAACAUCCCCGACUGGAAG
Takifugu rubripes
mml-miR-30a-3p miR-30 Macaca mulatta
CUUUCAGUCGGAUGUUUGCAGC
Macaca mulatta
bta-miR-30d miR-30 Bos taurus
UGUAAACAUCCCCGACUGGAAGCU
Ornithorhynchus anatinus
 
mmu-miR-30b* miR-30* Mus musculus
CUGGGAUGUGGAUGUUUACGUC
Mus musculus
 
bta-miR-30b miR-30 Bos taurus
UGUAAACAUCCUACACUCAGCU
Canis familiaris
 
hsa-miR-30b* miR-30* Homo sapiens
CUGGGAGGUGGAUGUUUACUUC
Homo sapiens
 
xtr-miR-30d miR-30 Xenopus tropicalis
UGUAAACAUCCCCGACUGGAAG
Xenopus tropicalis
gga-miR-30b miR-30 Gallus gallus
UGUAAACAUCCUACACUCAGCU
Gallus gallus
rno-miR-30d miR-30 Rattus norvegicus
UGUAAACAUCCCCGACUGGAAG
Rattus norvegicus
mml-miR-30b miR-30 Macaca mulatta
UGUAAACAUCCUACACUCAGC
Macaca mulatta
 
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
Tetraodon nigroviridis
dme-miR-31a miR-31 Drosophila melanogaster
UGGCAAGAUGUCGGCAUAGCUGA
Aedes aegypti
bta-miR-31 miR-31 Bos taurus
AGGCAAGAUGCUGGCAUAGCU
Canis familiaris
dme-miR-31b miR-31 Drosophila melanogaster
UGGCAAGAUGUCGGAAUAGCUG
Drosophila melanogaster
dps-miR-31b miR-31 Drosophila pseudoobscura
UGGCAAGAUGUCGGAAUAGCUGA
Drosophila pseudoobscura
dre-miR-31 miR-31 Danio rerio
GGCAAGAUGUUGGCAUAGCUG
Danio rerio
xtr-miR-31 miR-31 Xenopus tropicalis
AGGCAAGAUGUUGGCAUAGCUG
Xenopus tropicalis
dme-miR-31a miR-31 Drosophila melanogaster
UGGCAAGAUGUCGGCAUAGCUGA
Anopheles gambiae

Page 9 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 .. 88 next >>

spacer
spacer