spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 88 of 88
<< prev 1 .. 78 79 80 81 82 83 84 85 86 87 88

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
cel-miR-1018 miR-1018 Caenorhabditis elegans
AGAGAGAUCAUUGGACUUACAG
Caenorhabditis elegans
cel-miR-1018 miR-1018 Caenorhabditis elegans
AGAGAGAUCAUUGGACUUACAG
Caenorhabditis briggsae
 
cel-miR-1019 miR-1019 Caenorhabditis elegans
CUGUAAUUCCACAUUGCUUUCCAG
Caenorhabditis briggsae
cel-miR-1019 miR-1019 Caenorhabditis elegans
CUGUAAUUCCACAUUGCUUUCCAG
Caenorhabditis elegans
 
cel-miR-1020 miR-1020 Caenorhabditis elegans
AUUAUUCUGUGACACUUUCAG
Caenorhabditis elegans
cel-miR-1020 miR-1020 Caenorhabditis elegans
AUUAUUCUGUGACACUUUCAG
Caenorhabditis briggsae

Page 88 of 88
<< prev 1 .. 78 79 80 81 82 83 84 85 86 87 88

spacer
spacer