spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 7 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
bta-miR-23b miR-23 Bos taurus
AUCACAUUGCCAGGGAUUACCAC
Ornithorhynchus anatinus
tni-miR-23a miR-23 Tetraodon nigroviridis
AUCACAUUGCCAGGGAUUUCCA
Tetraodon nigroviridis
fru-miR-23b miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUACCA
Oryzias latipes
mdo-miR-23b miR-23 Monodelphis domestica
AUCACAUUGCCAGGGAUUACC
Monodelphis domestica
fru-miR-23a miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUUCCA
Takifugu rubripes
rno-miR-23a miR-23 Rattus norvegicus
AUCACAUUGCCAGGGAUUUCC
Rattus norvegicus
bta-miR-23b miR-23 Bos taurus
AUCACAUUGCCAGGGAUUACCAC
Bos taurus
fru-miR-23b miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUACCA
Gasterosteus aculeatus
mmu-miR-23a miR-23 Mus musculus
AUCACAUUGCCAGGGAUUUCC
Mus musculus
 
rno-miR-23a* miR-23* Rattus norvegicus
GGGGUUCCUGGGGAUGGGAUUU
Rattus norvegicus
 
xtr-miR-23b miR-23 Xenopus tropicalis
AUCACAUUGCCAGGGAUUACC
Xenopus tropicalis
bta-miR-23a miR-23 Bos taurus
AUCACAUUGCCAGGGAUUUCCA
Canis familiaris
hsa-miR-23b miR-23 Homo sapiens
AUCACAUUGCCAGGGAUUACC
Homo sapiens
bta-miR-23a miR-23 Bos taurus
AUCACAUUGCCAGGGAUUUCCA
Ornithorhynchus anatinus
ptr-miR-23b miR-23 Pan troglodytes
AUCACAUUGCCAGGGAUUACCAC
Pan troglodytes
 
hsa-miR-23b* miR-23* Homo sapiens
UGGGUUCCUGGCAUGCUGAUUU
Homo sapiens
 
dre-miR-23b miR-23 Danio rerio
AUCACAUUGCCAGGGAUUACCA
Danio rerio
fru-miR-23a miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUUCCA
Oryzias latipes
mdo-miR-23a miR-23 Monodelphis domestica
AUCACAUUGCCAGGGAUUUC
Monodelphis domestica
tni-miR-23b miR-23 Tetraodon nigroviridis
AUCACAUUGCCAGGGAUUACCA
Tetraodon nigroviridis
bta-miR-23a miR-23 Bos taurus
AUCACAUUGCCAGGGAUUUCCA
Bos taurus
fru-miR-23b miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUACCA
Takifugu rubripes
fru-miR-23a miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUUCCA
Gasterosteus aculeatus
 
bta-miR-24 miR-24 Bos taurus
UGGCUCAGUUCAGCAGGAACAG
Bos taurus
fru-miR-24 miR-24 Takifugu rubripes
UGGCUCAGUUCAGCAGGAACAG
Gasterosteus aculeatus
rno-miR-24 miR-24 Rattus norvegicus
UGGCUCAGUUCAGCAGGAACAG
Rattus norvegicus
xtr-miR-24a miR-24 Xenopus tropicalis
UGGCUCAGUUCAGCAGGAACAG
Xenopus tropicalis
ptr-miR-24 miR-24 Pan troglodytes
UGGCUCAGUUCAGCAGGAACAG
Pan troglodytes
 
mmu-miR-24-1* miR-24* Mus musculus
GUGCCUACUGAGCUGAUAUCAGU
Mus musculus
rno-miR-24-2* miR-24* Rattus norvegicus
GUGCCUACUGAGCUGAAACAGU
Rattus norvegicus
 
hsa-miR-24 miR-24 Homo sapiens
UGGCUCAGUUCAGCAGGAACAG
Homo sapiens
dre-miR-24 miR-24 Danio rerio
UGGCUCAGUUCAGCAGGAACAG
Danio rerio
 
hsa-miR-24-2* miR-24* Homo sapiens
UGCCUACUGAGCUGAAACACAG
Homo sapiens
 
tni-miR-24 miR-24 Tetraodon nigroviridis
UGGCUCAGUUCAGCAGGAACAG
Tetraodon nigroviridis
fru-miR-24 miR-24 Takifugu rubripes
UGGCUCAGUUCAGCAGGAACAG
Takifugu rubripes
mmu-miR-24 miR-24 Mus musculus
UGGCUCAGUUCAGCAGGAACAG
Mus musculus
mml-miR-24 miR-24 Macaca mulatta
UGGCUCAGUUCAGCAGGAACAG
Macaca mulatta
 
rno-miR-24-1* miR-24* Rattus norvegicus
GUGCCUACUGAGCUGAUAUCAG
Rattus norvegicus
 
gga-miR-24 miR-24 Gallus gallus
UGGCUCAGUUCAGCAGGAACAG
Gallus gallus
xtr-miR-24b miR-24 Xenopus tropicalis
UGGCUCAGUUCAGCAGGACAG
Xenopus tropicalis
bta-miR-24 miR-24 Bos taurus
UGGCUCAGUUCAGCAGGAACAG
Canis familiaris
bta-miR-24 miR-24 Bos taurus
UGGCUCAGUUCAGCAGGAACAG
Ornithorhynchus anatinus
 
mmu-miR-24-2* miR-24* Mus musculus
GUGCCUACUGAGCUGAAACAGU
Mus musculus
hsa-miR-24-1* miR-24* Homo sapiens
UGCCUACUGAGCUGAUAUCAGU
Homo sapiens
 
fru-miR-24 miR-24 Takifugu rubripes
UGGCUCAGUUCAGCAGGAACAG
Oryzias latipes
mdo-miR-24 miR-24 Monodelphis domestica
UGGCUCAGUUCAGCAG
Monodelphis domestica
 
tni-miR-25 miR-25 Tetraodon nigroviridis
CAUUGCACUUGUCUCGGUCUGA
Tetraodon nigroviridis
fru-miR-25 miR-25 Takifugu rubripes
CAUUGCACUUGUCUCGGUCUGA
Takifugu rubripes
mml-miR-25 miR-25 Macaca mulatta
CAUUGCACUUGUCUCGGUCUGA
Macaca mulatta
bta-miR-25 miR-25 Bos taurus
CAUUGCACUUGUCUCGGUCUGA
Gallus gallus
xtr-miR-25 miR-25 Xenopus tropicalis
CAUUGCACUUGUCUCGGUCUGA
Xenopus tropicalis
bta-miR-25 miR-25 Bos taurus
CAUUGCACUUGUCUCGGUCUGA
Canis familiaris
bta-miR-25 miR-25 Bos taurus
CAUUGCACUUGUCUCGGUCUGA
Ornithorhynchus anatinus
mmu-miR-25 miR-25 Mus musculus
CAUUGCACUUGUCUCGGUCUGA
Mus musculus
 
rno-miR-25* miR-25* Rattus norvegicus
AGGCGGAGACACGGGCAAUUGC
Rattus norvegicus
 
fru-miR-25 miR-25 Takifugu rubripes
CAUUGCACUUGUCUCGGUCUGA
Oryzias latipes
mdo-miR-25 miR-25 Monodelphis domestica
CAUUGCACUUGUCUCGGUCUGA
Monodelphis domestica
 
hsa-miR-25* miR-25* Homo sapiens
AGGCGGAGACUUGGGCAAUUG
Homo sapiens
 
bta-miR-25 miR-25 Bos taurus
CAUUGCACUUGUCUCGGUCUGA
Bos taurus
fru-miR-25 miR-25 Takifugu rubripes
CAUUGCACUUGUCUCGGUCUGA
Gasterosteus aculeatus
ptr-miR-25 miR-25 Pan troglodytes
CAUUGCACUUGUCUCGGCUGA
Pan troglodytes
rno-miR-25 miR-25 Rattus norvegicus
CAUUGCACUUGUCUCGGUCUGA
Rattus norvegicus
dre-miR-25 miR-25 Danio rerio
CAUUGCACUUGUCUCGGUCUGA
Danio rerio
hsa-miR-25 miR-25 Homo sapiens
CAUUGCACUUGUCUCGGUCUGA
Homo sapiens
 
dre-miR-26b miR-26 Danio rerio
UUCAAGUAAUCCAGGAUAGGUU
Danio rerio
fru-miR-26 miR-26 Takifugu rubripes
UUCAAGUAAUCCAGGAUAGGCU
Oryzias latipes
bta-miR-26a miR-26 Bos taurus
UUCAAGUAAUCCAGGAUAGGCU
Monodelphis domestica
 
rno-miR-26b* miR-26* Rattus norvegicus
CCUGUUCUCCAUUACUUGGCUC
Rattus norvegicus
mmu-miR-26b* miR-26* Mus musculus
CCUGUUCUCCAUUACUUGGCUC
Mus musculus
 
hsa-miR-26a miR-26 Homo sapiens
UUCAAGUAAUCCAGGAUAGGCU
Homo sapiens
bta-miR-26a miR-26 Bos taurus
UUCAAGUAAUCCAGGAUAGGCU
Bos taurus
 
hsa-miR-26a-1* miR-26* Homo sapiens
CCUAUUCUUGGUUACUUGCACG
Homo sapiens
 
fru-miR-26 miR-26 Takifugu rubripes
UUCAAGUAAUCCAGGAUAGGCU
Gasterosteus aculeatus
 
hsa-miR-26b* miR-26* Homo sapiens
CCUGUUCUCCAUUACUUGGCUC
Homo sapiens
 
ptr-miR-26a miR-26 Pan troglodytes
UUCAAGUAAUCCAGGAUAGGCU
Pan troglodytes
bta-miR-26b miR-26 Bos taurus
UUCAAGUAAUUCAGGAUAGGUU
Canis familiaris
dre-miR-26a miR-26 Danio rerio
UUCAAGUAAUCCAGGAUAGGCU
Danio rerio
bta-miR-26b miR-26 Bos taurus
UUCAAGUAAUUCAGGAUAGGUU
Ornithorhynchus anatinus
mmu-miR-26b miR-26 Mus musculus
UUCAAGUAAUUCAGGAUAGGU
Mus musculus
rno-miR-26b miR-26 Rattus norvegicus
UUCAAGUAAUUCAGGAUAGGU
Rattus norvegicus
tni-miR-26 miR-26 Tetraodon nigroviridis
UUCAAGUAAUCCAGGAUAGGCU
Tetraodon nigroviridis
bta-miR-26b miR-26 Bos taurus
UUCAAGUAAUUCAGGAUAGGUU
Monodelphis domestica
fru-miR-26 miR-26 Takifugu rubripes
UUCAAGUAAUCCAGGAUAGGCU
Takifugu rubripes
hsa-miR-26b miR-26 Homo sapiens
UUCAAGUAAUUCAGGAUAGGU
Homo sapiens
bta-miR-26b miR-26 Bos taurus
UUCAAGUAAUUCAGGAUAGGUU
Bos taurus
 
hsa-miR-26a-2* miR-26* Homo sapiens
CCUAUUCUUGAUUACUUGUUUC
Homo sapiens
 
mml-miR-26a miR-26 Macaca mulatta
UUCAAGUAAUCCAGGAUAGGCU
Macaca mulatta
gga-miR-26a miR-26 Gallus gallus
UUCAAGUAAUCCAGGAUAGGC
Gallus gallus
xtr-miR-26 miR-26 Xenopus tropicalis
UUCAAGUAAUCCAGGAUAGGC
Xenopus tropicalis
bta-miR-26a miR-26 Bos taurus
UUCAAGUAAUCCAGGAUAGGCU
Canis familiaris
bta-miR-26a miR-26 Bos taurus
UUCAAGUAAUCCAGGAUAGGCU
Ornithorhynchus anatinus
mmu-miR-26a miR-26 Mus musculus
UUCAAGUAAUCCAGGAUAGGCU
Mus musculus
rno-miR-26a miR-26 Rattus norvegicus
UUCAAGUAAUCCAGGAUAGGCU
Rattus norvegicus
 
hsa-miR-27a* miR-27* Homo sapiens
AGGGCUUAGCUGCUUGUGAGCA
Homo sapiens
 
bta-miR-27a miR-27 Bos taurus
UUCACAGUGGCUAAGUUCCG
Ornithorhynchus anatinus
tni-miR-27b miR-27 Tetraodon nigroviridis
UUCACAGUGGCUAAGUUCUGCA
Tetraodon nigroviridis
dre-miR-27b miR-27 Danio rerio
UUCACAGUGGCUAAGUUCUGCA
Danio rerio
fru-miR-27c miR-27 Takifugu rubripes
UUCACAGUGGUUAAGUUCUGC
Oryzias latipes
mdo-miR-27a miR-27 Monodelphis domestica
UUCACAGUGGCUAAGUUCCGC
Monodelphis domestica
fru-miR-27b miR-27 Takifugu rubripes
UUCACAGUGGCUAAGUUCUGCA
Takifugu rubripes

Page 7 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 .. 88 next >>

spacer
spacer