spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 6 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
gga-miR-19a miR-19 Gallus gallus
UGUGCAAAUCUAUGCAAAACUGA
Gallus gallus
fru-miR-19a miR-19 Takifugu rubripes
UGUGCAAAUCUAUGCAAAACUGA
Gasterosteus aculeatus
ptr-miR-19b miR-19 Pan troglodytes
UGUGCAAAUCCAUGCAAAACUGA
Pan troglodytes
 
dre-miR-19b* miR-19* Danio rerio
AGUUUUGCUGGUUUGCAUUCAG
Danio rerio
 
bta-miR-19b miR-19 Bos taurus
UGUGCAAAUCCAUGCAAAACUGA
Canis familiaris
mml-miR-19a miR-19 Macaca mulatta
UGUGCAAAUCUAUGCAAAACUGA
Macaca mulatta
hsa-miR-19b miR-19 Homo sapiens
UGUGCAAAUCCAUGCAAAACUGA
Homo sapiens
xtr-miR-19a miR-19 Xenopus tropicalis
UGUGCAAAUCUAUGCAAAACUGA
Xenopus tropicalis
dre-miR-19a miR-19 Danio rerio
UGUGCAAAUCUAUGCAAAACUGA
Danio rerio
mmu-miR-19b miR-19 Mus musculus
UGUGCAAAUCCAUGCAAAACUGA
Mus musculus
fru-miR-19a miR-19 Takifugu rubripes
UGUGCAAAUCUAUGCAAAACUGA
Oryzias latipes
tni-miR-19b miR-19 Tetraodon nigroviridis
UGUGCAAAUCCAUGCAAAACUGA
Tetraodon nigroviridis
 
ptr-miR-20 miR-20 Pan troglodytes
UAAAGUGCUUAUAGUGCAGGUA
Pan troglodytes
bta-miR-20b miR-20 Bos taurus
CAAAGUGCUCACAGUGCAGGUA
Ornithorhynchus anatinus
 
rno-miR-20a* miR-20* Rattus norvegicus
ACUGCAUUACGAGCACUUACA
Rattus norvegicus
 
tni-miR-20 miR-20 Tetraodon nigroviridis
UAAAGUGCUUAUAGUGCAGGUAG
Tetraodon nigroviridis
dre-miR-20a miR-20 Danio rerio
UAAAGUGCUUAUAGUGCAGGUAG
Danio rerio
bta-miR-20a miR-20 Bos taurus
UAAAGUGCUUAUAGUGCAGGUAG
Bos taurus
hsa-miR-20b miR-20 Homo sapiens
CAAAGUGCUCAUAGUGCAGGUAG
Homo sapiens
fru-miR-20 miR-20 Takifugu rubripes
UAAAGUGCUUAUAGUGCAGGUAG
Takifugu rubripes
 
dre-miR-20a* miR-20* Danio rerio
ACUGCAGUGUGAGCACUUGAAG
Danio rerio
 
mmu-miR-20a miR-20 Mus musculus
UAAAGUGCUUAUAGUGCAGGUAG
Mus musculus
xtr-miR-20b miR-20 Xenopus tropicalis
CAAAGUGCUCAUAGUGCAGGUAG
Xenopus tropicalis
 
hsa-miR-20b* miR-20* Homo sapiens
ACUGUAGUAUGGGCACUUCCAG
Homo sapiens
 
fru-miR-20 miR-20 Takifugu rubripes
UAAAGUGCUUAUAGUGCAGGUAG
Gasterosteus aculeatus
 
mmu-miR-20a* miR-20* Mus musculus
ACUGCAUUACGAGCACUUAAAG
Mus musculus
 
rno-miR-20a miR-20 Rattus norvegicus
UAAAGUGCUUAUAGUGCAGGUAG
Rattus norvegicus
bta-miR-20a miR-20 Bos taurus
UAAAGUGCUUAUAGUGCAGGUAG
Canis familiaris
bta-miR-20a miR-20 Bos taurus
UAAAGUGCUUAUAGUGCAGGUAG
Ornithorhynchus anatinus
rno-miR-20b-5p miR-20 Rattus norvegicus
CAAAGUGCUCAUAGUGCAGGU
Rattus norvegicus
gga-miR-20b miR-20 Gallus gallus
CAAAGUGCUCAUAGUGCAGGUAG
Gallus gallus
hsa-miR-20a miR-20 Homo sapiens
UAAAGUGCUUAUAGUGCAGGUAG
Homo sapiens
fru-miR-20 miR-20 Takifugu rubripes
UAAAGUGCUUAUAGUGCAGGUAG
Oryzias latipes
dre-miR-20b miR-20 Danio rerio
CAAAGUGCUCACAGUGCAGGUAG
Danio rerio
bta-miR-20b miR-20 Bos taurus
CAAAGUGCUCACAGUGCAGGUA
Bos taurus
xtr-miR-20a miR-20 Xenopus tropicalis
UAAAGUGCUUAUAGUGCAGGUAG
Xenopus tropicalis
 
hsa-miR-20a* miR-20* Homo sapiens
ACUGCAUUAUGAGCACUUAAAG
Homo sapiens
 
mml-miR-20 miR-20 Macaca mulatta
UAAAGUGCUUAUAGUGCAGGUA
Macaca mulatta
mmu-miR-20b miR-20 Mus musculus
CAAAGUGCUCAUAGUGCAGGUAG
Mus musculus
 
xtr-miR-20a* miR-20* Xenopus tropicalis
ACUGCAUAAUGAGCACUUAAA
Xenopus tropicalis
 
mdo-miR-20 miR-20 Monodelphis domestica
UAAAGUGCUUAUAGUGCAGGUAG
Monodelphis domestica
 
mmu-miR-20b* miR-20* Mus musculus
ACUGCAGUGUGAGCACUUCUAG
Mus musculus
 
rno-miR-20b-3p miR-20 Rattus norvegicus
ACUGCAGUGUGAGCACUUCUGG
Rattus norvegicus
bta-miR-20b miR-20 Bos taurus
CAAAGUGCUCACAGUGCAGGUA
Canis familiaris
gga-miR-20a miR-20 Gallus gallus
UAAAGUGCUUAUAGUGCAGGUAG
Gallus gallus
 
mmu-miR-21 miR-21 Mus musculus
UAGCUUAUCAGACUGAUGUUGA
Mus musculus
mdo-miR-21 miR-21 Monodelphis domestica
UAGCUUAUCAGACUGAUGUUGA
Monodelphis domestica
fru-miR-21 miR-21 Takifugu rubripes
UAGCUUAUCAGACUGGUGUUGGC
Takifugu rubripes
bta-miR-21 miR-21 Bos taurus
UAGCUUAUCAGACUGAUGUUGACU
Canis familiaris
ptr-miR-21 miR-21 Pan troglodytes
UAGCUUAUCAGACUGAUGUUGA
Pan troglodytes
bta-miR-21 miR-21 Bos taurus
UAGCUUAUCAGACUGAUGUUGACU
Ornithorhynchus anatinus
fru-miR-21 miR-21 Takifugu rubripes
UAGCUUAUCAGACUGGUGUUGGC
Gasterosteus aculeatus
gga-miR-21 miR-21 Gallus gallus
UAGCUUAUCAGACUGAUGUUGA
Gallus gallus
 
hsa-miR-21* miR-21* Homo sapiens
CAACACCAGUCGAUGGGCUGU
Homo sapiens
rno-miR-21* miR-21* Rattus norvegicus
CAACAGCAGUCGAUGGGCUGUC
Rattus norvegicus
 
dre-miR-21 miR-21 Danio rerio
UAGCUUAUCAGACUGGUGUUGGC
Danio rerio
 
bta-miR-21* miR-21* Bos taurus
AACAGCAGUCGAUGGGCUGUCU
Bos taurus
mmu-miR-21* miR-21* Mus musculus
CAACAGCAGUCGAUGGGCUGUC
Mus musculus
 
fru-miR-21 miR-21 Takifugu rubripes
UAGCUUAUCAGACUGGUGUUGGC
Oryzias latipes
tni-miR-21 miR-21 Tetraodon nigroviridis
UAGCUUAUCAGACUGGUGUUGGC
Tetraodon nigroviridis
hsa-miR-21 miR-21 Homo sapiens
UAGCUUAUCAGACUGAUGUUGA
Homo sapiens
rno-miR-21 miR-21 Rattus norvegicus
UAGCUUAUCAGACUGAUGUUGA
Rattus norvegicus
mml-miR-21 miR-21 Macaca mulatta
UAGCUUAUCAGACUGAUGUUGA
Macaca mulatta
bta-miR-21 miR-21 Bos taurus
UAGCUUAUCAGACUGAUGUUGACU
Bos taurus
fru-miR-21 miR-21 Takifugu rubripes
UAGCUUAUCAGACUGGUGUUGGC
Xenopus tropicalis
 
mmu-miR-22* miR-22* Mus musculus
AGUUCUUCAGUGGCAAGCUUUA
Mus musculus
 
xtr-miR-22 miR-22 Xenopus tropicalis
AAGCUGCCAGUUGAAGAACUGU
Xenopus tropicalis
fru-miR-22b miR-22 Takifugu rubripes
AAGCUGCCAGUUGAAGAGCUGU
Gasterosteus aculeatus
bta-miR-22-5p miR-22 Bos taurus
AGUUCUUCAGUGGCAAGCUUUA
Gallus gallus
mml-miR-22 miR-22 Macaca mulatta
AAGCUGCCAGUUGAAGAACUGU
Macaca mulatta
ptr-miR-22 miR-22 Pan troglodytes
AAGCUGCCAGUUGAAGAACUGU
Pan troglodytes
dre-miR-22a miR-22 Danio rerio
AAGCUGCCAGCUGAAGAACUGU
Danio rerio
 
rno-miR-22* miR-22* Rattus norvegicus
AGUUCUUCAGUGGCAAGCUUUA
Rattus norvegicus
 
fru-miR-22a miR-22 Takifugu rubripes
AAGCUGCCAGCUGAAGAACUGU
Takifugu rubripes
tni-miR-22b miR-22 Tetraodon nigroviridis
AAGCUGCCAGUUGAAGAGCUGU
Tetraodon nigroviridis
fru-miR-22b miR-22 Takifugu rubripes
AAGCUGCCAGUUGAAGAGCUGU
Oryzias latipes
hsa-miR-22 miR-22 Homo sapiens
AAGCUGCCAGUUGAAGAACUGU
Homo sapiens
mmu-miR-22 miR-22 Mus musculus
AAGCUGCCAGUUGAAGAACUGU
Mus musculus
fru-miR-22a miR-22 Takifugu rubripes
AAGCUGCCAGCUGAAGAACUGU
Gasterosteus aculeatus
bta-miR-22-5p miR-22 Bos taurus
AGUUCUUCAGUGGCAAGCUUUA
Canis familiaris
 
xtr-miR-22* miR-22* Xenopus tropicalis
AGUUCUUCAGUGGCAAGCUUU
Xenopus tropicalis
 
bta-miR-22-5p miR-22 Bos taurus
AGUUCUUCAGUGGCAAGCUUUA
Ornithorhynchus anatinus
mdo-miR-22 miR-22 Monodelphis domestica
AAGCUGCCAGUUGAAGAACUGC
Monodelphis domestica
rno-miR-22 miR-22 Rattus norvegicus
AAGCUGCCAGUUGAAGAACUGU
Rattus norvegicus
tni-miR-22a miR-22 Tetraodon nigroviridis
AAGCUGCCAGCUGAAGAACUGU
Tetraodon nigroviridis
fru-miR-22a miR-22 Takifugu rubripes
AAGCUGCCAGCUGAAGAACUGU
Oryzias latipes
dre-miR-22b miR-22 Danio rerio
AAGCUGCCAGUUGAAGAGCUGU
Danio rerio
bta-miR-22-5p miR-22 Bos taurus
AGUUCUUCAGUGGCAAGCUUUA
Bos taurus
fru-miR-22b miR-22 Takifugu rubripes
AAGCUGCCAGUUGAAGAGCUGU
Takifugu rubripes
 
hsa-miR-22* miR-22* Homo sapiens
AGUUCUUCAGUGGCAAGCUUUA
Homo sapiens
 
bta-miR-23a miR-23 Bos taurus
AUCACAUUGCCAGGGAUUUCCA
Canis familiaris
ptr-miR-23b miR-23 Pan troglodytes
AUCACAUUGCCAGGGAUUACCAC
Pan troglodytes
hsa-miR-23a miR-23 Homo sapiens
AUCACAUUGCCAGGGAUUUCC
Homo sapiens
bta-miR-23a miR-23 Bos taurus
AUCACAUUGCCAGGGAUUUCCA
Ornithorhynchus anatinus
tni-miR-23a miR-23 Tetraodon nigroviridis
AUCACAUUGCCAGGGAUUUCCA
Tetraodon nigroviridis
fru-miR-23a miR-23 Takifugu rubripes
AUCACAUUGCCAGGGAUUUCCA
Oryzias latipes
dre-miR-23b miR-23 Danio rerio
AUCACAUUGCCAGGGAUUACCA
Danio rerio
mdo-miR-23a miR-23 Monodelphis domestica
AUCACAUUGCCAGGGAUUUC
Monodelphis domestica
 
hsa-miR-23a* miR-23* Homo sapiens
GGGGUUCCUGGGGAUGGGAUUU
Homo sapiens
 
rno-miR-23b miR-23 Rattus norvegicus
AUCACAUUGCCAGGGAUUACC
Rattus norvegicus

Page 6 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 .. 88 next >>

spacer
spacer