spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 5 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
dre-miR-16a miR-16 Danio rerio
UAGCAGCACGUAAAUAUUGGUG
Danio rerio
fru-miR-16 miR-16 Takifugu rubripes
UAGCAGCACGUAAAUAUUGGAG
Oryzias latipes
xtr-miR-16b miR-16 Xenopus tropicalis
UAGCAGCACGUAAAUAUUGGGU
Xenopus tropicalis
dre-miR-16c miR-16 Danio rerio
UAGCAGCAUGUAAAUAUUGGAG
Danio rerio
 
mmu-miR-16* miR-16* Mus musculus
CCAGUAUUGACUGUGCUGCUGA
Mus musculus
 
hsa-miR-16 miR-16 Homo sapiens
UAGCAGCACGUAAAUAUUGGCG
Homo sapiens
 
hsa-miR-16-2* miR-16* Homo sapiens
CCAAUAUUACUGUGCUGCUUUA
Homo sapiens
 
bta-miR-16 miR-16 Bos taurus
UAGCAGCACGUAAAUAUUGGC
Canis familiaris
xtr-miR-16a miR-16 Xenopus tropicalis
UAGCAGCACGUAAAUAUUGGUG
Xenopus tropicalis
mml-miR-16 miR-16 Macaca mulatta
UAGCAGCACGUAAAUAUUGGCG
Macaca mulatta
dre-miR-16b miR-16 Danio rerio
UAGCAGCACGUAAAUAUUGGAG
Danio rerio
mmu-miR-16 miR-16 Mus musculus
UAGCAGCACGUAAAUAUUGGCG
Mus musculus
bta-miR-16 miR-16 Bos taurus
UAGCAGCACGUAAAUAUUGGC
Ornithorhynchus anatinus
bta-miR-16 miR-16 Bos taurus
UAGCAGCACGUAAAUAUUGGC
Bos taurus
xtr-miR-16c miR-16 Xenopus tropicalis
UAGCAGCACGUAAAUACUGGAG
Xenopus tropicalis
 
mmu-miR-17 miR-17 Mus musculus
CAAAGUGCUUACAGUGCAGGUAG
Mus musculus
bta-miR-17-5p miR-17 Bos taurus
CAAAGUGCUUACAGUGCAGGUAGU
Ornithorhynchus anatinus
bta-miR-17-5p miR-17 Bos taurus
CAAAGUGCUUACAGUGCAGGUAGU
Bos taurus
xtr-miR-17-5p miR-17 Xenopus tropicalis
CAAAGUGCUUACAGUGCAGGUAGU
Xenopus tropicalis
hsa-miR-17 miR-17 Homo sapiens
CAAAGUGCUUACAGUGCAGGUAG
Homo sapiens
mdo-miR-17-5p miR-17 Monodelphis domestica
CAAAGUGCUUACAGUGCAGGUAGU
Monodelphis domestica
rno-miR-17-3p miR-17 Rattus norvegicus
ACUGCAGUGAAGGCACUUGUGG
Rattus norvegicus
gga-miR-17-5p miR-17 Gallus gallus
CAAAGUGCUUACAGUGCAGGUAGU
Gallus gallus
bta-miR-17-3p miR-17 Bos taurus
ACUGCAGUGAAGGCACUUGU
Canis familiaris
ptr-miR-17-5p miR-17 Pan troglodytes
CAAAGUGCUUACAGUGCAGGUAGU
Pan troglodytes
mml-miR-17-3p miR-17 Macaca mulatta
ACUGCAGUGAAGGCACUUGU
Macaca mulatta
bta-miR-17-3p miR-17 Bos taurus
ACUGCAGUGAAGGCACUUGU
Ornithorhynchus anatinus
bta-miR-17-3p miR-17 Bos taurus
ACUGCAGUGAAGGCACUUGU
Bos taurus
xtr-miR-17-3p miR-17 Xenopus tropicalis
ACUGCAGUGAAGGCACUUGU
Xenopus tropicalis
 
dre-miR-17a* miR-17* Danio rerio
ACUGCAGUGGAGGCACUUCUAG
Danio rerio
 
mdo-miR-17-3p miR-17 Monodelphis domestica
ACUGCAGUGAAGGCACUUGUA
Monodelphis domestica
rno-miR-17 miR-17 Rattus norvegicus
CAAAGUGCUUACAGUGCAGGUAG
Rattus norvegicus
fru-miR-17 miR-17 Takifugu rubripes
CAAAGUGCUUACAGUGCAGGUA
Gasterosteus aculeatus
 
mmu-miR-17* miR-17* Mus musculus
ACUGCAGUGAGGGCACUUGUAG
Mus musculus
 
gga-miR-17-3p miR-17 Gallus gallus
ACUGCAGUGAAGGCACUUGU
Gallus gallus
 
hsa-miR-17* miR-17* Homo sapiens
ACUGCAGUGAAGGCACUUGUAG
Homo sapiens
 
ptr-miR-17-3p miR-17 Pan troglodytes
ACUGCAGUGAAGGCACUUGU
Pan troglodytes
tni-miR-17 miR-17 Tetraodon nigroviridis
CAAAGUGCUUACAGUGCAGGUA
Tetraodon nigroviridis
bta-miR-17-5p miR-17 Bos taurus
CAAAGUGCUUACAGUGCAGGUAGU
Canis familiaris
fru-miR-17 miR-17 Takifugu rubripes
CAAAGUGCUUACAGUGCAGGUA
Takifugu rubripes
fru-miR-17 miR-17 Takifugu rubripes
CAAAGUGCUUACAGUGCAGGUA
Oryzias latipes
mml-miR-17-5p miR-17 Macaca mulatta
CAAAGUGCUUACAGUGCAGGUAGU
Macaca mulatta
dre-miR-17a miR-17 Danio rerio
CAAAGUGCUUACAGUGCAGGUA
Danio rerio
 
dre-miR-18a miR-18 Danio rerio
UAAGGUGCAUCUAGUGCAGAUA
Danio rerio
fru-miR-18 miR-18 Takifugu rubripes
UAAGGUGCAUCUAGUGCAGAUA
Gasterosteus aculeatus
mmu-miR-18a miR-18 Mus musculus
UAAGGUGCAUCUAGUGCAGAUAG
Mus musculus
bta-miR-18b miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGUUA
Ornithorhynchus anatinus
bta-miR-18b miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGUUA
Bos taurus
xtr-miR-18b miR-18 Xenopus tropicalis
UAAGGUGCAUCUAGUGCAGUUAG
Xenopus tropicalis
dre-miR-18c miR-18 Danio rerio
UAAGGUGCAUCUUGUGUAGUUA
Danio rerio
hsa-miR-18a miR-18 Homo sapiens
UAAGGUGCAUCUAGUGCAGAUAG
Homo sapiens
 
mmu-miR-18a* miR-18* Mus musculus
ACUGCCCUAAGUGCUCCUUCUG
Mus musculus
 
gga-miR-18b miR-18 Gallus gallus
UAAGGUGCAUCUAGUGCAGUUA
Gallus gallus
tni-miR-18 miR-18 Tetraodon nigroviridis
UAAGGUGCAUCUAGUGCAGAUA
Tetraodon nigroviridis
 
hsa-miR-18a* miR-18* Homo sapiens
ACUGCCCUAAGUGCUCCUUCUGG
Homo sapiens
 
bta-miR-18a miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGAUA
Canis familiaris
fru-miR-18 miR-18 Takifugu rubripes
UAAGGUGCAUCUAGUGCAGAUA
Takifugu rubripes
fru-miR-18 miR-18 Takifugu rubripes
UAAGGUGCAUCUAGUGCAGAUA
Oryzias latipes
mml-miR-18 miR-18 Macaca mulatta
UAAGGUGCAUCUAGUGCAGAUA
Macaca mulatta
bta-miR-18a miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGAUA
Ornithorhynchus anatinus
bta-miR-18a miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGAUA
Bos taurus
xtr-miR-18a miR-18 Xenopus tropicalis
UAAGGUGCAUCUAGUGCAGAUA
Xenopus tropicalis
dre-miR-18b miR-18 Danio rerio
UAAGGUGCAUUUAGUGCAGAUA
Danio rerio
mdo-miR-18 miR-18 Monodelphis domestica
UAAGGUGCAUCUAGUGCAGAUA
Monodelphis domestica
rno-miR-18a miR-18 Rattus norvegicus
UAAGGUGCAUCUAGUGCAGAUAG
Rattus norvegicus
mmu-miR-18b miR-18 Mus musculus
UAAGGUGCAUCUAGUGCUGUUAG
Mus musculus
gga-miR-18a miR-18 Gallus gallus
UAAGGUGCAUCUAGUGCAGAUA
Gallus gallus
 
dre-miR-18b* miR-18* Danio rerio
CUGCCCUAAGUGCCCCUUCUGG
Danio rerio
 
hsa-miR-18b miR-18 Homo sapiens
UAAGGUGCAUCUAGUGCAGUUAG
Homo sapiens
ptr-miR-18 miR-18 Pan troglodytes
UAAGGUGCAUCUAGUGCAGAUA
Pan troglodytes
 
hsa-miR-18b* miR-18* Homo sapiens
UGCCCUAAAUGCCCCUUCUGGC
Homo sapiens
 
bta-miR-18b miR-18 Bos taurus
UAAGGUGCAUCUAGUGCAGUUA
Canis familiaris
 
bta-miR-19b miR-19 Bos taurus
UGUGCAAAUCCAUGCAAAACUGA
Ornithorhynchus anatinus
 
hsa-miR-19b-1* miR-19* Homo sapiens
AGUUUUGCAGGUUUGCAUCCAGC
Homo sapiens
 
mdo-miR-19b miR-19 Monodelphis domestica
UGUGCAAAUCCAUGCAAAACUGA
Monodelphis domestica
fru-miR-19b miR-19 Takifugu rubripes
UGUGCAAAUCCAUGCAAAACUGA
Takifugu rubripes
dre-miR-19c miR-19 Danio rerio
UGUGCAAAUCCAUGCAAAACUCG
Danio rerio
bta-miR-19b miR-19 Bos taurus
UGUGCAAAUCCAUGCAAAACUGA
Bos taurus
rno-miR-19b miR-19 Rattus norvegicus
UGUGCAAAUCCAUGCAAAACUGA
Rattus norvegicus
ptr-miR-19a miR-19 Pan troglodytes
UGUGCAAAUCUAUGCAAAACUGA
Pan troglodytes
 
dre-miR-19a* miR-19* Danio rerio
CUAGUUUUGCAUAGUUGCACUA
Danio rerio
 
gga-miR-19b miR-19 Gallus gallus
UGUGCAAAUCCAUGCAAAACUGA
Gallus gallus
fru-miR-19b miR-19 Takifugu rubripes
UGUGCAAAUCCAUGCAAAACUGA
Gasterosteus aculeatus
bta-miR-19a miR-19 Bos taurus
UGUGCAAAUCUAUGCAAAACUGA
Canis familiaris
hsa-miR-19a miR-19 Homo sapiens
UGUGCAAAUCUAUGCAAAACUGA
Homo sapiens
mmu-miR-19a miR-19 Mus musculus
UGUGCAAAUCUAUGCAAAACUGA
Mus musculus
mml-miR-19b miR-19 Macaca mulatta
UGUGCAAAUCCAUGCAAAACUGA
Macaca mulatta
tni-miR-19a miR-19 Tetraodon nigroviridis
UGUGCAAAUCUAUGCAAAACUGA
Tetraodon nigroviridis
bta-miR-19a miR-19 Bos taurus
UGUGCAAAUCUAUGCAAAACUGA
Ornithorhynchus anatinus
 
hsa-miR-19a* miR-19* Homo sapiens
AGUUUUGCAUAGUUGCACUACA
Homo sapiens
 
xtr-miR-19b miR-19 Xenopus tropicalis
UGUGCAAAUCCAUGCAAAACUGA
Xenopus tropicalis
mdo-miR-19a miR-19 Monodelphis domestica
UGUGCAAAUCUAUGCAAAACUGA
Monodelphis domestica
fru-miR-19a miR-19 Takifugu rubripes
UGUGCAAAUCUAUGCAAAACUGA
Takifugu rubripes
dre-miR-19b miR-19 Danio rerio
UGUGCAAAUCCAUGCAAAACUGA
Danio rerio
 
mmu-miR-19a* miR-19* Mus musculus
UAGUUUUGCAUAGUUGCACUAC
Mus musculus
 
fru-miR-19b miR-19 Takifugu rubripes
UGUGCAAAUCCAUGCAAAACUGA
Oryzias latipes
bta-miR-19a miR-19 Bos taurus
UGUGCAAAUCUAUGCAAAACUGA
Bos taurus
 
hsa-miR-19b-2* miR-19* Homo sapiens
AGUUUUGCAGGUUUGCAUUUCA
Homo sapiens
 
rno-miR-19a miR-19 Rattus norvegicus
UGUGCAAAUCUAUGCAAAACUGA
Rattus norvegicus
dre-miR-19d miR-19 Danio rerio
UGUGCAAACCCAUGCAAAACUGA
Danio rerio

Page 5 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 .. 88 next >>

spacer
spacer