spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 4 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
rno-miR-10b miR-10 Rattus norvegicus
CCCUGUAGAACCGAAUUUGUGU
Rattus norvegicus
fru-miR-10d miR-10 Takifugu rubripes
UACCCUGUAGAACCGAAUGUGUGUG
Gasterosteus aculeatus
dps-miR-10 miR-10 Drosophila pseudoobscura
ACCCUGUAGAUCCGAAUUUGU
Drosophila pseudoobscura
bta-miR-10b miR-10 Bos taurus
UACCCUGUAGAACCGAAUUUGUG
Canis familiaris
xtr-miR-10a miR-10 Xenopus tropicalis
UACCCUGUAGAUCCGAAUUUGUG
Xenopus tropicalis
hsa-miR-10a miR-10 Homo sapiens
UACCCUGUAGAUCCGAAUUUGUG
Macaca mulatta
dre-miR-10c miR-10 Danio rerio
UACCCUGUAGAUCCGGAUUUGU
Danio rerio
aga-miR-10 miR-10 Anopheles gambiae
ACCCUGUAGAUCCGAAUUUGU
Aedes aegypti
hsa-miR-10b miR-10 Homo sapiens
UACCCUGUAGAACCGAAUUUGUG
Homo sapiens
mmu-miR-10a miR-10 Mus musculus
UACCCUGUAGAUCCGAAUUUGUG
Mus musculus
mdo-miR-10b miR-10 Monodelphis domestica
AUACCCUGUAGAACCGAAUUUGU
Monodelphis domestica
hsa-miR-10b miR-10 Homo sapiens
UACCCUGUAGAACCGAAUUUGUG
Pan troglodytes
tni-miR-10b miR-10 Tetraodon nigroviridis
UACCCUGUAGAACCGAAUUUGUG
Tetraodon nigroviridis
aga-miR-10 miR-10 Anopheles gambiae
ACCCUGUAGAUCCGAAUUUGU
Anopheles gambiae
xtr-miR-10c miR-10 Xenopus tropicalis
CACCCUGUAGAAUCGAAUUUGU
Xenopus tropicalis
 
dre-miR-10a* miR-10* Danio rerio
CAAAUUCGUGUCUUGGGGAAUA
Danio rerio
hsa-miR-10b* miR-10* Homo sapiens
ACAGAUUCGAUUCUAGGGGAAU
Homo sapiens
mmu-miR-10a* miR-10* Mus musculus
CAAAUUCGUAUCUAGGGGAAUA
Mus musculus
 
bta-miR-10b miR-10 Bos taurus
UACCCUGUAGAACCGAAUUUGUG
Ornithorhynchus anatinus
bta-miR-10b miR-10 Bos taurus
UACCCUGUAGAACCGAAUUUGUG
Bos taurus
fru-miR-10c miR-10 Takifugu rubripes
UACCCUGUAGAUCCGGAUUUGU
Takifugu rubripes
tni-miR-10d miR-10 Tetraodon nigroviridis
UACCCUGUAGAACCGAAUGUGUGUG
Tetraodon nigroviridis
fru-miR-10c miR-10 Takifugu rubripes
UACCCUGUAGAUCCGGAUUUGU
Oryzias latipes
rno-miR-10a-5p miR-10 Rattus norvegicus
UACCCUGUAGAUCCGAAUUUGUG
Rattus norvegicus
fru-miR-10c miR-10 Takifugu rubripes
UACCCUGUAGAUCCGGAUUUGU
Gasterosteus aculeatus
bta-miR-10a miR-10 Bos taurus
UACCCUGUAGAUCCGAAUUUGUG
Canis familiaris
dre-miR-10b miR-10 Danio rerio
UACCCUGUAGAACCGAAUUUGUG
Danio rerio
hsa-miR-10a miR-10 Homo sapiens
UACCCUGUAGAUCCGAAUUUGUG
Homo sapiens
mdo-miR-10a miR-10 Monodelphis domestica
UACCCUGUAGAUCCGAAUUUGUG
Monodelphis domestica
hsa-miR-10a miR-10 Homo sapiens
UACCCUGUAGAUCCGAAUUUGUG
Pan troglodytes
dme-miR-10 miR-10 Drosophila melanogaster
ACCCUGUAGAUCCGAAUUUGU
Drosophila melanogaster
xtr-miR-10b miR-10 Xenopus tropicalis
UACCCUGUAGAACCGAAUUUGU
Xenopus tropicalis
hsa-miR-10b miR-10 Homo sapiens
UACCCUGUAGAACCGAAUUUGUG
Macaca mulatta
dre-miR-10d miR-10 Danio rerio
UACCCUGUAGAACCGAAUGUGUG
Danio rerio
 
hsa-miR-10a* miR-10* Homo sapiens
CAAAUUCGUAUCUAGGGGAAUA
Homo sapiens
 
mmu-miR-10b miR-10 Mus musculus
UACCCUGUAGAACCGAAUUUGUG
Mus musculus
bta-miR-10a miR-10 Bos taurus
UACCCUGUAGAUCCGAAUUUGUG
Ornithorhynchus anatinus
 
dme-miR-11 miR-11 Drosophila melanogaster
CAUCACAGUCUGAGUUCUUGC
Anopheles gambiae
dme-miR-11 miR-11 Drosophila melanogaster
CAUCACAGUCUGAGUUCUUGC
Drosophila melanogaster
dps-miR-11 miR-11 Drosophila pseudoobscura
CAUCACAGUCUGAGUUCUUGC
Drosophila pseudoobscura
dme-miR-11 miR-11 Drosophila melanogaster
CAUCACAGUCUGAGUUCUUGC
Aedes aegypti
 
dme-miR-12 miR-12 Drosophila melanogaster
UGAGUAUUACAUCAGGUACUGGU
Drosophila melanogaster
dps-miR-12 miR-12 Drosophila pseudoobscura
UGAGUAUUACAUCAGGUACUGGU
Drosophila pseudoobscura
dme-miR-12 miR-12 Drosophila melanogaster
UGAGUAUUACAUCAGGUACUGGU
Aedes aegypti
dme-miR-12 miR-12 Drosophila melanogaster
UGAGUAUUACAUCAGGUACUGGU
Anopheles gambiae
 
dps-miR-13a miR-13 Drosophila pseudoobscura
UAUCACAGCCAUUUUGAUGAGU
Drosophila pseudoobscura
aga-miR-13b miR-13 Anopheles gambiae
UAUCACAGCCAUUUUGACGAGU
Aedes aegypti
dme-miR-13b miR-13 Drosophila melanogaster
UAUCACAGCCAUUUUGACGAGU
Drosophila melanogaster
aga-miR-13b miR-13 Anopheles gambiae
UAUCACAGCCAUUUUGACGAGU
Anopheles gambiae
dps-miR-13b miR-13 Drosophila pseudoobscura
UAUCACAGCCAUUUUGACGAGU
Drosophila pseudoobscura
dme-miR-13a miR-13 Drosophila melanogaster
UAUCACAGCCAUUUUGAUGAGU
Drosophila melanogaster
 
aga-miR-14 miR-14 Anopheles gambiae
UCAGUCUUUUUCUCUCUCCUA
Aedes aegypti
dme-miR-14 miR-14 Drosophila melanogaster
UCAGUCUUUUUCUCUCUCCUA
Drosophila melanogaster
aga-miR-14 miR-14 Anopheles gambiae
UCAGUCUUUUUCUCUCUCCUA
Anopheles gambiae
dps-miR-14 miR-14 Drosophila pseudoobscura
UCAGUCUUUUUCUCUCUCCUA
Drosophila pseudoobscura
 
dre-miR-15b miR-15 Danio rerio
UAGCAGCACAUCAUGGUUUGUA
Danio rerio
bta-miR-15a miR-15 Bos taurus
UAGCAGCACAUAAUGGUUUGU
Canis familiaris
ptr-miR-15b miR-15 Pan troglodytes
UAGCAGCACAUCAUGGUUUACA
Pan troglodytes
rno-miR-15b miR-15 Rattus norvegicus
UAGCAGCACAUCAUGGUUUACA
Rattus norvegicus
 
mmu-miR-15a* miR-15* Mus musculus
CAGGCCAUACUGUGCUGCCUCA
Mus musculus
 
mml-miR-15b miR-15 Macaca mulatta
UAGCAGCACAUCAUGGUUUACA
Macaca mulatta
 
dre-miR-15a* miR-15* Danio rerio
CAGGCCGUACUGUGCUGCGGCA
Danio rerio
 
fru-miR-15a miR-15 Takifugu rubripes
UAGCAGCACGGAAUGGUUUGUG
Takifugu rubripes
bta-miR-15a miR-15 Bos taurus
UAGCAGCACAUAAUGGUUUGU
Ornithorhynchus anatinus
tni-miR-15b miR-15 Tetraodon nigroviridis
UAGCAGCGCAUCAUGGUUUGUA
Tetraodon nigroviridis
fru-miR-15a miR-15 Takifugu rubripes
UAGCAGCACGGAAUGGUUUGUG
Oryzias latipes
hsa-miR-15b miR-15 Homo sapiens
UAGCAGCACAUCAUGGUUUACA
Homo sapiens
xtr-miR-15b miR-15 Xenopus tropicalis
UAGCAGCACAUCAUGAUUUGCA
Xenopus tropicalis
bta-miR-15a miR-15 Bos taurus
UAGCAGCACAUAAUGGUUUGU
Bos taurus
gga-miR-15a miR-15 Gallus gallus
UAGCAGCACAUAAUGGUUUGU
Gallus gallus
fru-miR-15a miR-15 Takifugu rubripes
UAGCAGCACGGAAUGGUUUGUG
Gasterosteus aculeatus
 
hsa-miR-15b* miR-15* Homo sapiens
CGAAUCAUUAUUUGCUGCUCUA
Homo sapiens
 
dre-miR-15a miR-15 Danio rerio
UAGCAGCACAGAAUGGUUUGUG
Danio rerio
ptr-miR-15a miR-15 Pan troglodytes
UAGCAGCACAUAAUGGUUUGUG
Pan troglodytes
mmu-miR-15b miR-15 Mus musculus
UAGCAGCACAUCAUGGUUUACA
Mus musculus
mml-miR-15a miR-15 Macaca mulatta
UAGCAGCACAUAAUGGUUUGUG
Macaca mulatta
dre-miR-15c miR-15 Danio rerio
AAGCAGCGCGUCAUGGUUUUC
Danio rerio
bta-miR-15b miR-15 Bos taurus
UAGCAGCACAUCAUGGUUUACA
Canis familiaris
tni-miR-15a miR-15 Tetraodon nigroviridis
UAGCAGCACGGAAUGGUUUGUG
Tetraodon nigroviridis
 
mmu-miR-15b* miR-15* Mus musculus
CGAAUCAUUAUUUGCUGCUCUA
Mus musculus
 
fru-miR-15b miR-15 Takifugu rubripes
UAGCAGCGCAUCAUGGUUUGUA
Takifugu rubripes
bta-miR-15b miR-15 Bos taurus
UAGCAGCACAUCAUGGUUUACA
Ornithorhynchus anatinus
hsa-miR-15a miR-15 Homo sapiens
UAGCAGCACAUAAUGGUUUGUG
Homo sapiens
xtr-miR-15a miR-15 Xenopus tropicalis
UAGCAGCACAUAAUGGUUUGUG
Xenopus tropicalis
fru-miR-15b miR-15 Takifugu rubripes
UAGCAGCGCAUCAUGGUUUGUA
Oryzias latipes
 
hsa-miR-15a* miR-15* Homo sapiens
CAGGCCAUAUUGUGCUGCCUCA
Homo sapiens
 
xtr-miR-15c miR-15 Xenopus tropicalis
UAGCAGCACAUCAUGGUUUGUA
Xenopus tropicalis
bta-miR-15b miR-15 Bos taurus
UAGCAGCACAUCAUGGUUUACA
Bos taurus
mdo-miR-15a miR-15 Monodelphis domestica
UAGCAGCACAUAAUGGUUUGUU
Monodelphis domestica
gga-miR-15b miR-15 Gallus gallus
UAGCAGCACAUCAUGGUUUGCA
Gallus gallus
mmu-miR-15a miR-15 Mus musculus
UAGCAGCACAUAAUGGUUUGUG
Mus musculus
fru-miR-15b miR-15 Takifugu rubripes
UAGCAGCGCAUCAUGGUUUGUA
Gasterosteus aculeatus
 
dre-miR-16a miR-16 Danio rerio
UAGCAGCACGUAAAUAUUGGUG
Danio rerio
fru-miR-16 miR-16 Takifugu rubripes
UAGCAGCACGUAAAUAUUGGAG
Takifugu rubripes
 
hsa-miR-16-1* miR-16* Homo sapiens
CCAGUAUUAACUGUGCUGCUGA
Homo sapiens
 
fru-miR-16 miR-16 Takifugu rubripes
UAGCAGCACGUAAAUAUUGGAG
Oryzias latipes
dre-miR-16c miR-16 Danio rerio
UAGCAGCAUGUAAAUAUUGGAG
Danio rerio
xtr-miR-16b miR-16 Xenopus tropicalis
UAGCAGCACGUAAAUAUUGGGU
Xenopus tropicalis
mmu-miR-16 miR-16 Mus musculus
UAGCAGCACGUAAAUAUUGGCG
Mus musculus
fru-miR-16 miR-16 Takifugu rubripes
UAGCAGCACGUAAAUAUUGGAG
Gasterosteus aculeatus

Page 4 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 .. 88 next >>

spacer
spacer