spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 3 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
dps-miR-2c miR-2 Drosophila pseudoobscura
UAUCACAGCCAGCUUUGAUGGGC
Drosophila pseudoobscura
cel-miR-2 miR-2 Caenorhabditis elegans
UAUCACAGCCAGCUUUGAUGUGC
Caenorhabditis briggsae
 
dps-miR-3 miR-3 Drosophila pseudoobscura
UCACUGGGCAAAGUGUGUCUCA
Drosophila pseudoobscura
dme-miR-3 miR-3 Drosophila melanogaster
UCACUGGGCAAAGUGUGUCUCA
Aedes aegypti
dme-miR-3 miR-3 Drosophila melanogaster
UCACUGGGCAAAGUGUGUCUCA
Anopheles gambiae
dme-miR-3 miR-3 Drosophila melanogaster
UCACUGGGCAAAGUGUGUCUCA
Drosophila melanogaster
 
dme-miR-4 miR-4 Drosophila melanogaster
AUAAAGCUAGACAACCAUUGA
Drosophila melanogaster
dme-miR-4 miR-4 Drosophila melanogaster
AUAAAGCUAGACAACCAUUGA
Aedes aegypti
dme-miR-4 miR-4 Drosophila melanogaster
AUAAAGCUAGACAACCAUUGA
Anopheles gambiae
dps-miR-4 miR-4 Drosophila pseudoobscura
AUAAAGCUAGACAACCAUUGA
Drosophila pseudoobscura
 
dps-miR-5 miR-5 Drosophila pseudoobscura
AAAGGAACGAUCGUUGUGAUAUG
Drosophila pseudoobscura
dme-miR-5 miR-5 Drosophila melanogaster
AAAGGAACGAUCGUUGUGAUAUG
Drosophila melanogaster
dme-miR-5 miR-5 Drosophila melanogaster
AAAGGAACGAUCGUUGUGAUAUG
Aedes aegypti
dme-miR-5 miR-5 Drosophila melanogaster
AAAGGAACGAUCGUUGUGAUAUG
Anopheles gambiae
 
dps-miR-6 miR-6 Drosophila pseudoobscura
UAUCACAGUGGCUGUUCUUUUU
Drosophila pseudoobscura
dme-miR-6 miR-6 Drosophila melanogaster
UAUCACAGUGGCUGUUCUUUUU
Drosophila melanogaster
dme-miR-6 miR-6 Drosophila melanogaster
UAUCACAGUGGCUGUUCUUUUU
Aedes aegypti
dme-miR-6 miR-6 Drosophila melanogaster
UAUCACAGUGGCUGUUCUUUUU
Anopheles gambiae
 
hsa-miR-7-1* miR-7* Homo sapiens
CAACAAAUCACAGUCUGCCAUA
Homo sapiens
 
dre-miR-7a miR-7 Danio rerio
UGGAAGACUAGUGAUUUUGUUGU
Danio rerio
 
rno-miR-7a* miR-7* Rattus norvegicus
ACAACAAAUCACAGUCUGCCAU
Rattus norvegicus
 
gga-miR-7b miR-7 Gallus gallus
UGGAAGACUAGUGAUUUUUGUU
Gallus gallus
mmu-miR-7b miR-7 Mus musculus
UGGAAGACUUGUGAUUUUGUUGU
Mus musculus
bta-miR-7 miR-7 Bos taurus
UGGAAGACUAGUGAUUUUGUUGUU
Bos taurus
fru-miR-7 miR-7 Takifugu rubripes
UGGAAGACUAGUGAUUUUGUU
Takifugu rubripes
bta-miR-7 miR-7 Bos taurus
UGGAAGACUAGUGAUUUUGUUGUU
Canis familiaris
hsa-miR-7 miR-7 Homo sapiens
UGGAAGACUAGUGAUUUUGUUGU
Macaca mulatta
mdo-miR-7 miR-7 Monodelphis domestica
UGGAAGACUAGUGAUUUUGUUG
Monodelphis domestica
ptr-miR-7 miR-7 Pan troglodytes
UGGAAGACUAGUGAUUUUGUU
Pan troglodytes
hsa-miR-7 miR-7 Homo sapiens
UGGAAGACUAGUGAUUUUGUUGU
Homo sapiens
bta-miR-7 miR-7 Bos taurus
UGGAAGACUAGUGAUUUUGUUGUU
Ornithorhynchus anatinus
rno-miR-7b miR-7 Rattus norvegicus
UGGAAGACUUGUGAUUUUGUUGU
Rattus norvegicus
 
hsa-miR-7-2* miR-7* Homo sapiens
CAACAAAUCCCAGUCUACCUAA
Homo sapiens
 
dps-miR-7 miR-7 Drosophila pseudoobscura
UGGAAGACUAGUGAUUUUGUUGU
Drosophila pseudoobscura
mmu-miR-7a miR-7 Mus musculus
UGGAAGACUAGUGAUUUUGUUGU
Mus musculus
gga-miR-7 miR-7 Gallus gallus
UGGAAGACUAGUGAUUUUGUUG
Gallus gallus
dre-miR-7b miR-7 Danio rerio
UGGAAGACUUGUGAUUUUGUU
Danio rerio
fru-miR-7 miR-7 Takifugu rubripes
UGGAAGACUAGUGAUUUUGUU
Oryzias latipes
dme-miR-7 miR-7 Drosophila melanogaster
UGGAAGACUAGUGAUUUUGUUGU
Drosophila melanogaster
 
mmu-miR-7a* miR-7* Mus musculus
CAACAAAUCACAGUCUGCCAUA
Mus musculus
 
aga-miR-7 miR-7 Anopheles gambiae
UGGAAGACUAGUGAUUUUGUUGU
Aedes aegypti
xtr-miR-7 miR-7 Xenopus tropicalis
UGGAAGACUAGUGAUUUUGUUG
Xenopus tropicalis
aga-miR-7 miR-7 Anopheles gambiae
UGGAAGACUAGUGAUUUUGUUGU
Anopheles gambiae
tni-miR-7 miR-7 Tetraodon nigroviridis
UGGAAGACUAGUGAUUUUGUUGU
Tetraodon nigroviridis
rno-miR-7a miR-7 Rattus norvegicus
UGGAAGACUAGUGAUUUUGUUGU
Rattus norvegicus
fru-miR-7 miR-7 Takifugu rubripes
UGGAAGACUAGUGAUUUUGUU
Gasterosteus aculeatus
 
aga-miR-8 miR-8 Anopheles gambiae
UAAUACUGUCAGGUAAAGAUGUC
Anopheles gambiae
dps-miR-8 miR-8 Drosophila pseudoobscura
UAAUACUGUCAGGUAAAGAUGUC
Drosophila pseudoobscura
dme-miR-8 miR-8 Drosophila melanogaster
UAAUACUGUCAGGUAAAGAUGUC
Drosophila melanogaster
aga-miR-8 miR-8 Anopheles gambiae
UAAUACUGUCAGGUAAAGAUGUC
Aedes aegypti
 
dre-miR-9 miR-9 Danio rerio
UCUUUGGUUAUCUAGCUGUAUGA
Danio rerio
aga-miR-9a miR-9 Anopheles gambiae
UCUUUGGUUAUCUAGCUGUAUGA
Aedes aegypti
 
rno-miR-9* miR-9* Rattus norvegicus
AUAAAGCUAGAUAACCGAAAGU
Rattus norvegicus
 
dme-miR-9c miR-9 Drosophila melanogaster
UCUUUGGUAUUCUAGCUGUAGA
Drosophila melanogaster
xtr-miR-9 miR-9 Xenopus tropicalis
UCUUUGGUUAUCUAGCUGUAUG
Xenopus tropicalis
tni-miR-9 miR-9 Tetraodon nigroviridis
UCUUUGGUUAUCUAGCUGUAUGA
Tetraodon nigroviridis
hsa-miR-9 miR-9 Homo sapiens
UCUUUGGUUAUCUAGCUGUAUGA
Homo sapiens
aga-miR-9a miR-9 Anopheles gambiae
UCUUUGGUUAUCUAGCUGUAUGA
Anopheles gambiae
aga-miR-9c miR-9 Anopheles gambiae
UCUUUGGUAUUCUAGCUGUAGA
Aedes aegypti
fru-miR-9 miR-9 Takifugu rubripes
UCUUUGGUUAUCUAGCUGUAUGA
Gasterosteus aculeatus
xtr-miR-9b miR-9 Xenopus tropicalis
UCUUUGGUUACCUAGCUGUAUGA
Xenopus tropicalis
hsa-miR-9 miR-9 Homo sapiens
UCUUUGGUUAUCUAGCUGUAUGA
Ornithorhynchus anatinus
aga-miR-9c miR-9 Anopheles gambiae
UCUUUGGUAUUCUAGCUGUAGA
Anopheles gambiae
 
gga-miR-9* miR-9* Gallus gallus
UAAAGCUAGAGAACCGAAUGU
Gallus gallus
xtr-miR-9b* miR-9* Xenopus tropicalis
UAAAGCUAGACAACCGAACGU
Xenopus tropicalis
 
mmu-miR-9 miR-9 Mus musculus
UCUUUGGUUAUCUAGCUGUAUGA
Mus musculus
dps-miR-9b miR-9 Drosophila pseudoobscura
UCUUUGGUGAUUUUAGCUGUAUG
Drosophila pseudoobscura
fru-miR-9 miR-9 Takifugu rubripes
UCUUUGGUUAUCUAGCUGUAUGA
Takifugu rubripes
rno-miR-9 miR-9 Rattus norvegicus
UCUUUGGUUAUCUAGCUGUAUGA
Rattus norvegicus
dme-miR-9b miR-9 Drosophila melanogaster
UCUUUGGUGAUUUUAGCUGUAUG
Drosophila melanogaster
 
mdo-miR-9* miR-9* Monodelphis domestica
UAAAGCUAGAUAACCGAAAGU
Monodelphis domestica
dre-miR-9* miR-9* Danio rerio
UAAAGCUAGAUAACCGAAAGU
Danio rerio
 
aga-miR-9b miR-9 Anopheles gambiae
ACUUUGGUGAUUUUAGCUGUAUG
Aedes aegypti
xtr-miR-9a miR-9 Xenopus tropicalis
UCUUUGGUUAUCUAGCUGUAUGA
Xenopus tropicalis
 
hsa-miR-9* miR-9* Homo sapiens
AUAAAGCUAGAUAACCGAAAGU
Homo sapiens
 
aga-miR-9b miR-9 Anopheles gambiae
ACUUUGGUGAUUUUAGCUGUAUG
Anopheles gambiae
gga-miR-9 miR-9 Gallus gallus
UCUUUGGUUAUCUAGCUGUAUGA
Gallus gallus
 
xtr-miR-9* miR-9* Xenopus tropicalis
UAAAGCUAGAUAACCGAAAGU
Xenopus tropicalis
 
hsa-miR-9 miR-9 Homo sapiens
UCUUUGGUUAUCUAGCUGUAUGA
Bos taurus
dps-miR-9a miR-9 Drosophila pseudoobscura
UCUUUGGUUAUCUAGCUGUAUGA
Drosophila pseudoobscura
hsa-miR-9 miR-9 Homo sapiens
UCUUUGGUUAUCUAGCUGUAUGA
Canis familiaris
 
mmu-miR-9* miR-9* Mus musculus
AUAAAGCUAGAUAACCGAAAGU
Mus musculus
 
fru-miR-9 miR-9 Takifugu rubripes
UCUUUGGUUAUCUAGCUGUAUGA
Oryzias latipes
dme-miR-9a miR-9 Drosophila melanogaster
UCUUUGGUUAUCUAGCUGUAUGA
Drosophila melanogaster
dps-miR-9c miR-9 Drosophila pseudoobscura
UCUUUGGUAUUCUAGCUGUAGA
Drosophila pseudoobscura
ptr-miR-9 miR-9 Pan troglodytes
UCUUUGGUUAUCUAGCUGUAUGA
Pan troglodytes
hsa-miR-9 miR-9 Homo sapiens
UCUUUGGUUAUCUAGCUGUAUGA
Macaca mulatta
mdo-miR-9 miR-9 Monodelphis domestica
UCUUUGGUUAUCUAGCUGUAUGA
Monodelphis domestica
 
dre-miR-10d* miR-10* Danio rerio
CAGAUUCGGUUUUAGGGGAGUA
Danio rerio
 
xtr-miR-10c miR-10 Xenopus tropicalis
CACCCUGUAGAAUCGAAUUUGU
Xenopus tropicalis
hsa-miR-10b miR-10 Homo sapiens
UACCCUGUAGAACCGAAUUUGUG
Homo sapiens
aga-miR-10 miR-10 Anopheles gambiae
ACCCUGUAGAUCCGAAUUUGU
Anopheles gambiae
rno-miR-10a-5p miR-10 Rattus norvegicus
UACCCUGUAGAUCCGAAUUUGUG
Rattus norvegicus
mmu-miR-10b miR-10 Mus musculus
UACCCUGUAGAACCGAAUUUGUG
Mus musculus
fru-miR-10c miR-10 Takifugu rubripes
UACCCUGUAGAUCCGGAUUUGU
Oryzias latipes
 
hsa-miR-10b* miR-10* Homo sapiens
ACAGAUUCGAUUCUAGGGGAAU
Homo sapiens
 
fru-miR-10c miR-10 Takifugu rubripes
UACCCUGUAGAUCCGGAUUUGU
Takifugu rubripes
dme-miR-10 miR-10 Drosophila melanogaster
ACCCUGUAGAUCCGAAUUUGU
Drosophila melanogaster
bta-miR-10b miR-10 Bos taurus
UACCCUGUAGAACCGAAUUUGUG
Ornithorhynchus anatinus
dre-miR-10a miR-10 Danio rerio
UACCCUGUAGAUCCGAAUUUGU
Danio rerio

Page 3 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 .. 88 next >>

spacer
spacer