spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 2 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
hsa-let-7f let-7 Homo sapiens
UGAGGUAGUAGAUUGUAUAGUU
Homo sapiens
 
mmu-let-7d* let-7* Mus musculus
CUAUACGACCUGCUGCCUUUCU
Mus musculus
 
fru-let-7d let-7 Takifugu rubripes
UGAGGUAGUUGGUUGUAUGGUU
Takifugu rubripes
dre-let-7a let-7 Danio rerio
UGAGGUAGUAGGUUGUAUAGUU
Danio rerio
fru-let-7h let-7 Takifugu rubripes
UGAGGUAGUAAGUUGUGUUGUU
Gasterosteus aculeatus
bta-let-7a let-7 Bos taurus
UGAGGUAGUAGGUUGUAUAGUU
Ornithorhynchus anatinus
hsa-let-7e let-7 Homo sapiens
UGAGGUAGGAGGUUGUAUAGUU
Macaca mulatta
fru-let-7d let-7 Takifugu rubripes
UGAGGUAGUUGGUUGUAUGGUU
Oryzias latipes
 
rno-let-7d* let-7* Rattus norvegicus
CUAUACGACCUGCUGCCUUUCU
Rattus norvegicus
 
xtr-let-7g let-7 Xenopus tropicalis
UGAGGUAGUUGUUUGUACAGU
Xenopus tropicalis
mdo-let-7d let-7 Monodelphis domestica
AGAGGUAGUAGGUUGCAUAGU
Monodelphis domestica
mmu-let-7e let-7 Mus musculus
UGAGGUAGGAGGUUGUAUAGUU
Mus musculus
 
hsa-let-7f-2* let-7* Homo sapiens
CUAUACAGUCUACUGUCUUUCC
Homo sapiens
 
tni-let-7g let-7 Tetraodon nigroviridis
UGAGGUAGUAGUUUGUAUAGUU
Tetraodon nigroviridis
dre-let-7j let-7 Danio rerio
UGAGGUAGUUGUUUGUACAGUU
Danio rerio
gga-let-7b let-7 Gallus gallus
UGAGGUAGUAGGUUGUGUGGUU
Gallus gallus
hsa-let-7i let-7 Homo sapiens
UGAGGUAGUAGUUUGUGCUGUU
Pan troglodytes
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
Bos taurus
rno-let-7b let-7 Rattus norvegicus
UGAGGUAGUAGGUUGUGUGGUU
Rattus norvegicus
bta-let-7g let-7 Bos taurus
UGAGGUAGUAGUUUGUACAGUU
Canis familiaris
hsa-let-7i let-7 Homo sapiens
UGAGGUAGUAGUUUGUGCUGUU
Homo sapiens
 
mmu-let-7g* let-7* Mus musculus
ACUGUACAGGCCACUGCCUUGC
Mus musculus
 
fru-let-7g let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUAUAGUU
Takifugu rubripes
 
hsa-let-7i* let-7* Homo sapiens
CUGCGCAAGCUACUGCCUUGCU
Homo sapiens
 
dre-let-7c let-7 Danio rerio
UGAGGUAGUAGGUUGUAUGGUU
Danio rerio
fru-let-7j let-7 Takifugu rubripes
UGAGGUAGUUUUUUGUACAGUU
Gasterosteus aculeatus
hsa-let-7a let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUAGUU
Pan troglodytes
bta-let-7c let-7 Bos taurus
UGAGGUAGUAGGUUGUAUGGUU
Ornithorhynchus anatinus
hsa-let-7g let-7 Homo sapiens
UGAGGUAGUAGUUUGUACAGUU
Macaca mulatta
fru-let-7g let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUAUAGUU
Oryzias latipes
 
rno-let-7i* let-7* Rattus norvegicus
CUGCGCAAGCUACUGCCUUGCU
Rattus norvegicus
 
mdo-let-7g let-7 Monodelphis domestica
UGAGGUAGUAGUUUGUACAGU
Monodelphis domestica
hsa-let-7a let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUAGUU
Homo sapiens
mmu-let-7g let-7 Mus musculus
UGAGGUAGUAGUUUGUACAGUU
Mus musculus
fru-let-7a let-7 Takifugu rubripes
UGAGGUAGUAGGUUGUAUAGUU
Gasterosteus aculeatus
tni-let-7i let-7 Tetraodon nigroviridis
UGAGGUAGUAGUUUGUGCUGUU
Tetraodon nigroviridis
gga-let-7d let-7 Gallus gallus
AGAGGUAGUGGGUUGCAUAGU
Gallus gallus
bta-let-7b let-7 Bos taurus
UGAGGUAGUAGGUUGUGUGGUU
Bos taurus
 
bta-let-7a* let-7* Bos taurus
CUAUACAAUCUACUGUCUUUC
Bos taurus
 
rno-let-7d let-7 Rattus norvegicus
AGAGGUAGUAGGUUGCAUAGUU
Rattus norvegicus
xtr-let-7a let-7 Xenopus tropicalis
UGAGGUAGUAGGUUGUAUAGUU
Xenopus tropicalis
aga-let-7 let-7 Anopheles gambiae
UGAGGUAGUUGGUUGUAUAGU
Aedes aegypti
 
hsa-let-7b* let-7* Homo sapiens
CUAUACAACCUACUGCCUUCCC
Homo sapiens
 
fru-let-7i let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUGCUGUU
Takifugu rubripes
dre-let-7e let-7 Danio rerio
UGAGGUAGUAGAUUGAAUAGUU
Danio rerio
hsa-let-7c let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUGGUU
Pan troglodytes
dps-let-7 let-7 Drosophila pseudoobscura
UGAGGUAGUAGGUUGUAUAGU
Drosophila pseudoobscura
bta-let-7e let-7 Bos taurus
UGAGGUAGGAGGUUGUAUAGU
Ornithorhynchus anatinus
fru-let-7i let-7 Takifugu rubripes
UGAGGUAGUAGUUUGUGCUGUU
Oryzias latipes
bta-let-7b let-7 Bos taurus
UGAGGUAGUAGGUUGUGUGGUU
Canis familiaris
hsa-let-7c let-7 Homo sapiens
UGAGGUAGUAGGUUGUAUGGUU
Homo sapiens
 
mmu-let-7a* let-7* Mus musculus
CUAUACAAUCUACUGUCUUUCC
Mus musculus
 
fru-let-7d let-7 Takifugu rubripes
UGAGGUAGUUGGUUGUAUGGUU
Gasterosteus aculeatus
gga-let-7g let-7 Gallus gallus
UGAGGUAGUAGUUUGUACAGU
Gallus gallus
bta-let-7d let-7 Bos taurus
AGAGGUAGUAGGUUGCAUAGUU
Bos taurus
hsa-let-7b let-7 Homo sapiens
UGAGGUAGUAGGUUGUGUGGUU
Macaca mulatta
rno-let-7f let-7 Rattus norvegicus
UGAGGUAGUAGAUUGUAUAGUU
Rattus norvegicus
aga-let-7 let-7 Anopheles gambiae
UGAGGUAGUUGGUUGUAUAGU
Anopheles gambiae
xtr-let-7c let-7 Xenopus tropicalis
UGAGGUAGUAGGUUGUAUGGUU
Xenopus tropicalis
mmu-let-7b let-7 Mus musculus
UGAGGUAGUAGGUUGUGUGGUU
Mus musculus
 
hsa-let-7d* let-7* Homo sapiens
CUAUACGACCUGCUGCCUUUCU
Homo sapiens
 
dme-miR-iab-4-3p miR-iab Drosophila melanogaster
CGGUAUACCUUCAGUAUACGUAAC
Drosophila melanogaster
dps-miR-iab-4-5p miR-iab Drosophila pseudoobscura
ACGUAUACUGAAUGUAUCCUGA
Drosophila pseudoobscura
dme-miR-iab-4-5p miR-iab Drosophila melanogaster
ACGUAUACUGAAUGUAUCCUGA
Drosophila melanogaster
dps-miR-iab-4-3p miR-iab Drosophila pseudoobscura
CGGUAUACCUUCAGUAUACGUAAC
Drosophila pseudoobscura
aga-miR-iab-4 miR-iab Anopheles gambiae
ACGUAUACUGAAUGUAUCCUGA
Aedes aegypti
aga-miR-iab-4 miR-iab Anopheles gambiae
ACGUAUACUGAAUGUAUCCUGA
Anopheles gambiae
 
cbr-miR-1 miR-1 Caenorhabditis briggsae
UGGAAUGUAAAGAAGUAUGUA
Caenorhabditis briggsae
fru-miR-1 miR-1 Takifugu rubripes
UGGAAUGUAAAGAAGUAUGUAU
Oryzias latipes
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
Ornithorhynchus anatinus
gga-miR-1b miR-1 Gallus gallus
UGGAAUGUUAAGAAGUAUGUA
Gallus gallus
dre-miR-1 miR-1 Danio rerio
UGGAAUGUAAAGAAGUAUGUAU
Danio rerio
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
Pan troglodytes
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
Homo sapiens
fru-miR-1 miR-1 Takifugu rubripes
UGGAAUGUAAAGAAGUAUGUAU
Gasterosteus aculeatus
rno-miR-1 miR-1 Rattus norvegicus
UGGAAUGUAAAGAAGUGUGUAU
Rattus norvegicus
xtr-miR-1b miR-1 Xenopus tropicalis
UGGAAUGUUAAGAAGUAUGUA
Xenopus tropicalis
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
Bos taurus
aga-miR-1 miR-1 Anopheles gambiae
UGGAAUGUAAAGAAGUAUGGAG
Aedes aegypti
dps-miR-1 miR-1 Drosophila pseudoobscura
UGGAAUGUAAAGAAGUAUGGAG
Drosophila pseudoobscura
aga-miR-1 miR-1 Anopheles gambiae
UGGAAUGUAAAGAAGUAUGGAG
Anopheles gambiae
gga-miR-1a miR-1 Gallus gallus
UGGAAUGUAAAGAAGUAUGUA
Gallus gallus
xtr-miR-1a miR-1 Xenopus tropicalis
UGGAAUGUAAAGAAGUAUGUA
Xenopus tropicalis
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
Canis familiaris
cel-miR-1 miR-1 Caenorhabditis elegans
UGGAAUGUAAAGAAGUAUGUA
Caenorhabditis elegans
mmu-miR-1 miR-1 Mus musculus
UGGAAUGUAAAGAAGUAUGUAU
Mus musculus
dme-miR-1 miR-1 Drosophila melanogaster
UGGAAUGUAAAGAAGUAUGGAG
Drosophila melanogaster
hsa-miR-1 miR-1 Homo sapiens
UGGAAUGUAAAGAAGUAUGUAU
Macaca mulatta
 
rno-miR-1* miR-1* Rattus norvegicus
GCACAUACUUCUUUAUGUACCC
Rattus norvegicus
 
mdo-miR-1 miR-1 Monodelphis domestica
UGGAAUGUAAAGAAGUAUGUA
Monodelphis domestica
tni-miR-1 miR-1 Tetraodon nigroviridis
UGGAAUGUAAAGAAGUAUGUAU
Tetraodon nigroviridis
fru-miR-1 miR-1 Takifugu rubripes
UGGAAUGUAAAGAAGUAUGUAU
Takifugu rubripes
 
aga-miR-2 miR-2 Anopheles gambiae
GCUCAUCAAAGCUGGCUGUGAUA
Aedes aegypti
aga-miR-2 miR-2 Anopheles gambiae
GCUCAUCAAAGCUGGCUGUGAUA
Anopheles gambiae
dps-miR-2b miR-2 Drosophila pseudoobscura
UAUCACAGCCAGCUUUGAGGAGC
Drosophila pseudoobscura
dme-miR-2b miR-2 Drosophila melanogaster
UAUCACAGCCAGCUUUGAGGAGC
Drosophila melanogaster
dps-miR-2a miR-2 Drosophila pseudoobscura
UAUCACAGCCAGCUUUGAUGAGC
Drosophila pseudoobscura
cel-miR-2 miR-2 Caenorhabditis elegans
UAUCACAGCCAGCUUUGAUGUGC
Caenorhabditis elegans
dme-miR-2a miR-2 Drosophila melanogaster
UAUCACAGCCAGCUUUGAUGAGC
Drosophila melanogaster
dps-miR-2c miR-2 Drosophila pseudoobscura
UAUCACAGCCAGCUUUGAUGGGC
Drosophila pseudoobscura

Page 2 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 .. 88 next >>

spacer
spacer