spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 11 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
mmu-miR-34c* miR-34* Mus musculus
AAUCACUAACCACACAGCCAGG
Mus musculus
 
dre-miR-34 miR-34 Danio rerio
UGGCAGUGUCUUAGCUGGUUGU
Takifugu rubripes
bta-miR-34c miR-34 Bos taurus
AGGCAGUGUAGUUAGCUGAUUG
Bos taurus
bta-miR-34b miR-34 Bos taurus
AGGCAGUGUAAUUAGCUGAUUG
Canis familiaris
dre-miR-34b miR-34 Danio rerio
UAGGCAGUGUUGUUAGCUGAUUG
Danio rerio
hsa-miR-34a miR-34 Homo sapiens
UGGCAGUGUCUUAGCUGGUUGU
Homo sapiens
dre-miR-34c miR-34 Danio rerio
AGGCAGUGCAGUUAGUUGAUUAC
Takifugu rubripes
dre-miR-34b miR-34 Danio rerio
UAGGCAGUGUUGUUAGCUGAUUG
Tetraodon nigroviridis
dre-miR-34b miR-34 Danio rerio
UAGGCAGUGUUGUUAGCUGAUUG
Oryzias latipes
bta-miR-34b miR-34 Bos taurus
AGGCAGUGUAAUUAGCUGAUUG
Ornithorhynchus anatinus
xtr-miR-34b miR-34 Xenopus tropicalis
CAGGCAGUGUAGUUAGCUGAUUG
Xenopus tropicalis
dre-miR-34b miR-34 Danio rerio
UAGGCAGUGUUGUUAGCUGAUUG
Gasterosteus aculeatus
cbr-miR-34 miR-34 Caenorhabditis briggsae
AGGCAGUGUGGUUAGCUGGUUG
Caenorhabditis briggsae
hsa-miR-34c-3p miR-34 Homo sapiens
AAUCACUAACCACACGGCCAGG
Homo sapiens
rno-miR-34a miR-34 Rattus norvegicus
UGGCAGUGUCUUAGCUGGUUGU
Rattus norvegicus
mmu-miR-34b-3p miR-34 Mus musculus
AAUCACUAACUCCACUGCCAUC
Mus musculus
 
cbr-miR-35 miR-35 Caenorhabditis briggsae
UCACCGGGUGAAAACUUGCAAG
Caenorhabditis briggsae
cel-miR-35 miR-35 Caenorhabditis elegans
UCACCGGGUGGAAACUAGCAGU
Caenorhabditis elegans
 
cel-miR-36 miR-36 Caenorhabditis elegans
UCACCGGGUGAAAAUUCGCAUG
Caenorhabditis elegans
cbr-miR-36 miR-36 Caenorhabditis briggsae
UCACCGGGUGAAAAUUCGCAAU
Caenorhabditis briggsae
 
cel-miR-37 miR-37 Caenorhabditis elegans
UCACCGGGUGAACACUUGCAGU
Caenorhabditis briggsae
cel-miR-37 miR-37 Caenorhabditis elegans
UCACCGGGUGAACACUUGCAGU
Caenorhabditis elegans
 
cbr-miR-38 miR-38 Caenorhabditis briggsae
UCACCGGGAGACAACCUGGUAU
Caenorhabditis briggsae
cel-miR-38 miR-38 Caenorhabditis elegans
UCACCGGGAGAAAAACUGGAGU
Caenorhabditis elegans
 
cbr-miR-39 miR-39 Caenorhabditis briggsae
UCACCGGGUGAAAAACGGUUAG
Caenorhabditis briggsae
cel-miR-39 miR-39 Caenorhabditis elegans
UCACCGGGUGUAAAUCAGCUUG
Caenorhabditis elegans
 
cbr-miR-40 miR-40 Caenorhabditis briggsae
UCACCGGGUGUCAAUCAGCUAG
Caenorhabditis briggsae
cel-miR-40 miR-40 Caenorhabditis elegans
UCACCGGGUGUACAUCAGCUAA
Caenorhabditis elegans
 
cel-miR-41 miR-41 Caenorhabditis elegans
UCACCGGGUGAAAAAUCACCUA
Caenorhabditis elegans
cbr-miR-41 miR-41 Caenorhabditis briggsae
UCACCGGGUGAAAAACUCCCA
Caenorhabditis briggsae
 
cbr-miR-42 miR-42 Caenorhabditis briggsae
CACCGGGUUAACAUCUACAG
Caenorhabditis briggsae
cel-miR-42 miR-42 Caenorhabditis elegans
UCACCGGGUUAACAUCUACAGA
Caenorhabditis elegans
 
cel-miR-43 miR-43 Caenorhabditis elegans
UAUCACAGUUUACUUGCUGUCGC
Caenorhabditis elegans
cbr-miR-43 miR-43 Caenorhabditis briggsae
UAUCACAGUUUACUUGCUGUCGC
Caenorhabditis briggsae
 
cbr-miR-44 miR-44 Caenorhabditis briggsae
UGACUAGAGACACAUUCAGCU
Caenorhabditis briggsae
cel-miR-44 miR-44 Caenorhabditis elegans
UGACUAGAGACACAUUCAGCU
Caenorhabditis elegans
 
cbr-miR-46 miR-46 Caenorhabditis briggsae
UGUCAUGGAGUCGCUCUCUUCA
Caenorhabditis briggsae
cel-miR-46 miR-46 Caenorhabditis elegans
UGUCAUGGAGUCGCUCUCUUCA
Caenorhabditis elegans
 
cbr-miR-47 miR-47 Caenorhabditis briggsae
UGUCAUGGAGGCGCUCUCUUCA
Caenorhabditis briggsae
cel-miR-47 miR-47 Caenorhabditis elegans
UGUCAUGGAGGCGCUCUCUUCA
Caenorhabditis elegans
 
cbr-miR-48 miR-48 Caenorhabditis briggsae
UGAGGUAGGCUCAGUAGAUGCGA
Caenorhabditis briggsae
cel-miR-48 miR-48 Caenorhabditis elegans
UGAGGUAGGCUCAGUAGAUGCGA
Caenorhabditis elegans
 
cbr-miR-49 miR-49 Caenorhabditis briggsae
AAGCACCACGAGAAGCUGCAGA
Caenorhabditis briggsae
cel-miR-49 miR-49 Caenorhabditis elegans
AAGCACCACGAGAAGCUGCAGA
Caenorhabditis elegans
 
cbr-miR-50 miR-50 Caenorhabditis briggsae
UGAUAUGUCUGAUAUUCUUGGGUU
Caenorhabditis briggsae
cel-miR-50 miR-50 Caenorhabditis elegans
UGAUAUGUCUGGUAUUCUUGGG
Caenorhabditis elegans
 
cel-miR-51 miR-51 Caenorhabditis elegans
UACCCGUAGCUCCUAUCCAUGUU
Caenorhabditis elegans
cbr-miR-51 miR-51 Caenorhabditis briggsae
UACCCGUAGCUCCUUGCCAUGUU
Caenorhabditis briggsae
 
cbr-miR-52 miR-52 Caenorhabditis briggsae
CACCCGUACAUAUGUUUCCGUGCU
Caenorhabditis briggsae
cel-miR-52 miR-52 Caenorhabditis elegans
CACCCGUACAUAUGUUUCCGUGCU
Caenorhabditis elegans
 
cel-miR-53 miR-53 Caenorhabditis elegans
CACCCGUACAUUUGUUUCCGUGCU
Caenorhabditis briggsae
cel-miR-53 miR-53 Caenorhabditis elegans
CACCCGUACAUUUGUUUCCGUGCU
Caenorhabditis elegans
 
cel-miR-54 miR-54 Caenorhabditis elegans
UACCCGUAAUCUUCAUAAUCCGAG
Caenorhabditis briggsae
cel-miR-54 miR-54 Caenorhabditis elegans
UACCCGUAAUCUUCAUAAUCCGAG
Caenorhabditis elegans
 
cbr-miR-55 miR-55 Caenorhabditis briggsae
UACCCGUAUAUUUUUCUGCCGAG
Caenorhabditis briggsae
cel-miR-55 miR-55 Caenorhabditis elegans
UACCCGUAUAAGUUUCUGCUGAG
Caenorhabditis elegans
 
cel-miR-56* miR-56* Caenorhabditis elegans
UGGCGGAUCCAUUUUGGGUUGUA
Caenorhabditis elegans
 
cel-miR-56 miR-56 Caenorhabditis elegans
UACCCGUAAUGUUUCCGCUGAG
Caenorhabditis briggsae
cel-miR-56 miR-56 Caenorhabditis elegans
UACCCGUAAUGUUUCCGCUGAG
Caenorhabditis elegans
 
cel-miR-57 miR-57 Caenorhabditis elegans
UACCCUGUAGAUCGAGCUGUGUGU
Caenorhabditis elegans
cbr-miR-57 miR-57 Caenorhabditis briggsae
UACCCUGUAGAUCGAGCUGUGUGU
Caenorhabditis briggsae
 
cel-miR-58 miR-58 Caenorhabditis elegans
UGAGAUCGUUCAGUACGGCAAU
Caenorhabditis elegans
cbr-miR-58 miR-58 Caenorhabditis briggsae
UGAGAUCGUUCAGUACGGCAAU
Caenorhabditis briggsae
 
cel-miR-59 miR-59 Caenorhabditis elegans
UCGAAUCGUUUAUCAGGAUGAUG
Caenorhabditis elegans
cel-miR-59 miR-59 Caenorhabditis elegans
UCGAAUCGUUUAUCAGGAUGAUG
Caenorhabditis briggsae
 
cel-miR-60 miR-60 Caenorhabditis elegans
UAUUAUGCACAUUUUCUAGUUCA
Caenorhabditis elegans
cbr-miR-60 miR-60 Caenorhabditis briggsae
UAUUAUGCACAUUUUCUAGUCCA
Caenorhabditis briggsae
 
cel-miR-61 miR-61 Caenorhabditis elegans
UGACUAGAACCGUUACUCAUC
Caenorhabditis elegans
cbr-miR-61 miR-61 Caenorhabditis briggsae
UGACUAGAACCUUGACUCUGCUC
Caenorhabditis briggsae
 
cbr-miR-62 miR-62 Caenorhabditis briggsae
UGAUAUGUAAUCUAGCUUACAG
Caenorhabditis briggsae
cel-miR-62 miR-62 Caenorhabditis elegans
UGAUAUGUAAUCUAGCUUACAG
Caenorhabditis elegans
 
cel-miR-63 miR-63 Caenorhabditis elegans
UAUGACACUGAAGCGAGUUGGAAA
Caenorhabditis elegans
cel-miR-63 miR-63 Caenorhabditis elegans
UAUGACACUGAAGCGAGUUGGAAA
Caenorhabditis briggsae
 
cbr-miR-64 miR-64 Caenorhabditis briggsae
CAUGACACUGAAGCGUGUACGGA
Caenorhabditis briggsae
cel-miR-64 miR-64 Caenorhabditis elegans
UAUGACACUGAAGCGUUACCGAA
Caenorhabditis elegans
 
cel-miR-65 miR-65 Caenorhabditis elegans
UAUGACACUGAAGCGUAACCGAA
Caenorhabditis elegans
cel-miR-65 miR-65 Caenorhabditis elegans
UAUGACACUGAAGCGUAACCGAA
Caenorhabditis briggsae
 
cel-miR-66 miR-66 Caenorhabditis elegans
CAUGACACUGAUUAGGGAUGUGA
Caenorhabditis elegans
cel-miR-66 miR-66 Caenorhabditis elegans
CAUGACACUGAUUAGGGAUGUGA
Caenorhabditis briggsae
 
cel-miR-67 miR-67 Caenorhabditis elegans
UCACAACCUCCUAGAAAGAGUAGA
Caenorhabditis elegans
cbr-miR-67 miR-67 Caenorhabditis briggsae
UCACAACCUCCUAGAAAGAGUAGA
Caenorhabditis briggsae
 
cel-miR-70 miR-70 Caenorhabditis elegans
UAAUACGUCGUUGGUGUUUCCAU
Caenorhabditis elegans
cbr-miR-70 miR-70 Caenorhabditis briggsae
UAAUACGUGAUUGGUGUUCCCAG
Caenorhabditis briggsae
 
cbr-miR-71 miR-71 Caenorhabditis briggsae
UGAAAGACAUGGGUAGUGA
Caenorhabditis briggsae
cel-miR-71 miR-71 Caenorhabditis elegans
UGAAAGACAUGGGUAGUGA
Caenorhabditis elegans
 
cel-miR-72 miR-72 Caenorhabditis elegans
AGGCAAGAUGUUGGCAUAGCUGA
Caenorhabditis elegans
cbr-miR-72 miR-72 Caenorhabditis briggsae
AGGCAGAUGUUGGCAUAGC
Caenorhabditis briggsae
 
cbr-miR-73 miR-73 Caenorhabditis briggsae
UGGCAAGAUGUUGGCAGUUCAGU
Caenorhabditis briggsae
cel-miR-73 miR-73 Caenorhabditis elegans
UGGCAAGAUGUAGGCAGUUCAGU
Caenorhabditis elegans
 
cel-miR-74 miR-74 Caenorhabditis elegans
UGGCAAGAAAUGGCAGUCUACA
Caenorhabditis elegans
cbr-miR-74 miR-74 Caenorhabditis briggsae
UGGCAAGAAAUGGCAGUCUAGA
Caenorhabditis briggsae
 
cel-miR-75 miR-75 Caenorhabditis elegans
UUAAAGCUACCAACCGGCUUCA
Caenorhabditis elegans
cbr-miR-75 miR-75 Caenorhabditis briggsae
UUAAAGCUACCAACCGCCUUCA
Caenorhabditis briggsae
 
cel-miR-76 miR-76 Caenorhabditis elegans
UUCGUUGUUGAUGAAGCCUUGA
Caenorhabditis elegans
cel-miR-76 miR-76 Caenorhabditis elegans
UUCGUUGUUGAUGAAGCCUUGA
Caenorhabditis briggsae
 
cel-miR-77 miR-77 Caenorhabditis elegans
UUCAUCAGGCCAUAGCUGUCCA
Caenorhabditis elegans
cbr-miR-77 miR-77 Caenorhabditis briggsae
UUCAUCAGGCCAUAGCUGUCCA
Caenorhabditis briggsae
 
cel-miR-78 miR-78 Caenorhabditis elegans
UGGAGGCCUGGUUGUUUGUGC
Caenorhabditis elegans
cel-miR-78 miR-78 Caenorhabditis elegans
UGGAGGCCUGGUUGUUUGUGC
Caenorhabditis briggsae
 
aga-miR-79 miR-79 Anopheles gambiae
UAAAGCUAGAUUACCAAAGCAU
Aedes aegypti

Page 11 of 88
<< prev 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 .. 88 next >>

spacer
spacer