spacer

Full MicroRNA Listing for (All Species)


8706 microRNAs


Page 1 of 88
1 2 3 4 5 6 7 8 9 10 11 .. 88 next >>

miRNA ID Family Source Species Sequence Search Genome
picture button picture button picture button picture button picture button
 
aga-bantam bantam Anopheles gambiae
UGAGAUCACUUUGAAAGCUGAUU
Aedes aegypti
 
aga-let-7 let-7 Anopheles gambiae
UGAGGUAGUUGGUUGUAUAGU
Aedes aegypti
 
aga-miR-iab-4 miR-iab Anopheles gambiae
ACGUAUACUGAAUGUAUCCUGA
Aedes aegypti
 
aga-miR-1 miR-1 Anopheles gambiae
UGGAAUGUAAAGAAGUAUGGAG
Aedes aegypti
 
aga-miR-2 miR-2 Anopheles gambiae
GCUCAUCAAAGCUGGCUGUGAUA
Aedes aegypti
 
dme-miR-3 miR-3 Drosophila melanogaster
UCACUGGGCAAAGUGUGUCUCA
Aedes aegypti
 
dme-miR-4 miR-4 Drosophila melanogaster
AUAAAGCUAGACAACCAUUGA
Aedes aegypti
 
dme-miR-5 miR-5 Drosophila melanogaster
AAAGGAACGAUCGUUGUGAUAUG
Aedes aegypti
 
dme-miR-6 miR-6 Drosophila melanogaster
UAUCACAGUGGCUGUUCUUUUU
Aedes aegypti
 
aga-miR-7 miR-7 Anopheles gambiae
UGGAAGACUAGUGAUUUUGUUGU
Aedes aegypti
 
aga-miR-8 miR-8 Anopheles gambiae
UAAUACUGUCAGGUAAAGAUGUC
Aedes aegypti
 
aga-miR-9a miR-9 Anopheles gambiae
UCUUUGGUUAUCUAGCUGUAUGA
Aedes aegypti
aga-miR-9c miR-9 Anopheles gambiae
UCUUUGGUAUUCUAGCUGUAGA
Aedes aegypti
aga-miR-9b miR-9 Anopheles gambiae
ACUUUGGUGAUUUUAGCUGUAUG
Aedes aegypti
 
aga-miR-10 miR-10 Anopheles gambiae
ACCCUGUAGAUCCGAAUUUGU
Aedes aegypti
 
dme-miR-11 miR-11 Drosophila melanogaster
CAUCACAGUCUGAGUUCUUGC
Aedes aegypti
 
dme-miR-12 miR-12 Drosophila melanogaster
UGAGUAUUACAUCAGGUACUGGU
Aedes aegypti
 
aga-miR-13b miR-13 Anopheles gambiae
UAUCACAGCCAUUUUGACGAGU
Aedes aegypti
 
aga-miR-14 miR-14 Anopheles gambiae
UCAGUCUUUUUCUCUCUCCUA
Aedes aegypti
 
dme-miR-31b miR-31 Drosophila melanogaster
UGGCAAGAUGUCGGAAUAGCUG
Aedes aegypti
dme-miR-31a miR-31 Drosophila melanogaster
UGGCAAGAUGUCGGCAUAGCUGA
Aedes aegypti
 
dme-miR-33 miR-33 Drosophila melanogaster
AGGUGCAUUGUAGUCGCAUUG
Aedes aegypti
 
dme-miR-34 miR-34 Drosophila melanogaster
UGGCAGUGUGGUUAGCUGGUUGUG
Aedes aegypti
 
aga-miR-79 miR-79 Anopheles gambiae
UAAAGCUAGAUUACCAAAGCAU
Aedes aegypti
 
dme-miR-87 miR-87 Drosophila melanogaster
UUGAGCAAAAUUUCAGGUGUG
Aedes aegypti
 
aga-miR-92b miR-92 Anopheles gambiae
AAUUGCACUUGUCCCGGCCUGC
Aedes aegypti
aga-miR-92a miR-92 Anopheles gambiae
UAUUGCACUUGUCCCGGCCUAU
Aedes aegypti
 
aga-miR-100 miR-100 Anopheles gambiae
AACCCGUAGAUCCGAACUUGUG
Aedes aegypti
 
aga-miR-124 miR-124 Anopheles gambiae
UAAGGCACGCGGUGAAUGCCAAG
Aedes aegypti
 
aga-miR-125 miR-125 Anopheles gambiae
UCCCUGAGACCCUAACUUGUGA
Aedes aegypti
 
aga-miR-133 miR-133 Anopheles gambiae
UUGGUCCCCUUCAACCAGCUGU
Aedes aegypti
 
aga-miR-184 miR-184 Anopheles gambiae
UGGACGGAGAACUGAUAAGGG
Aedes aegypti
 
aga-miR-210 miR-210 Anopheles gambiae
UUGUGCGUGUGACAACGGCUA
Aedes aegypti
 
aga-miR-219 miR-219 Anopheles gambiae
UGAUUGUCCAAACGCAAUUCUUG
Aedes aegypti
 
aga-miR-263 miR-263 Anopheles gambiae
UGUAAUGGCACUGGAAGAAUUCAC
Aedes aegypti
 
dme-miR-274 miR-274 Drosophila melanogaster
UUUUGUGACCGACACUAACGGGUAAU
Aedes aegypti
 
aga-miR-275 miR-275 Anopheles gambiae
UCAGGUACCUGAAGUAGCGCGCG
Aedes aegypti
 
aga-miR-276 miR-276 Anopheles gambiae
CAGCGAGGUAUAGAGUUCCUACG
Aedes aegypti
 
aga-miR-277 miR-277 Anopheles gambiae
UAAAUGCACUAUCUGGUACGACA
Aedes aegypti
 
aga-miR-278 miR-278 Anopheles gambiae
UCGGUGGGACUUUCGUCCGUUU
Aedes aegypti
 
aga-miR-279 miR-279 Anopheles gambiae
UGACUAGAUCCACACUCAUUAA
Aedes aegypti
 
dme-miR-280 miR-280 Drosophila melanogaster
UGUAUUUACGUUGCAUAUGAAAUGAUA
Aedes aegypti
 
aga-miR-281 miR-281 Anopheles gambiae
UGUCAUGGAAUUGCUCUCUUUAU
Aedes aegypti
 
aga-miR-282 miR-282 Anopheles gambiae
AAUCUAGCCUCUUCUAGGCUUUGUCUGU
Aedes aegypti
 
aga-miR-283 miR-283 Anopheles gambiae
UAAAUAUCAGCUGGUAAUUCU
Aedes aegypti
 
dme-miR-284 miR-284 Drosophila melanogaster
UGAAGUCAGCAACUUGAUUCCAGCAAUUG
Aedes aegypti
 
dme-miR-285 miR-285 Drosophila melanogaster
UAGCACCAUUCGAAAUCAGUGC
Aedes aegypti
 
dme-miR-286 miR-286 Drosophila melanogaster
UGACUAGACCGAACACUCGUGCU
Aedes aegypti
 
dme-miR-287 miR-287 Drosophila melanogaster
UGUGUUGAAAAUCGUUUGCAC
Aedes aegypti
 
dme-miR-288 miR-288 Drosophila melanogaster
UUUCAUGUCGAUUUCAUUUCAUG
Aedes aegypti
 
dme-miR-289 miR-289 Drosophila melanogaster
UAAAUAUUUAAGUGGAGCCUGCGACU
Aedes aegypti
 
dme-miR-303 miR-303 Drosophila melanogaster
UUUAGGUUUCACAGGAAACUGGU
Aedes aegypti
 
dme-miR-304 miR-304 Drosophila melanogaster
UAAUCUCAAUUUGUAAAUGUGAG
Aedes aegypti
 
aga-miR-305 miR-305 Anopheles gambiae
AUUGUACUUCAUCAGGUGCUCUG
Aedes aegypti
 
dme-miR-306 miR-306 Drosophila melanogaster
UCAGGUACUUAGUGACUCUCAA
Aedes aegypti
 
aga-miR-307 miR-307 Anopheles gambiae
UCACAACCUCCUUGAGUGAG
Aedes aegypti
 
aga-miR-308 miR-308 Anopheles gambiae
AAUCACAGGAGUAUACUGUGAG
Aedes aegypti
 
dme-miR-309 miR-309 Drosophila melanogaster
GCACUGGGUAAAGUUUGUCCUA
Aedes aegypti
 
dme-miR-310 miR-310 Drosophila melanogaster
UAUUGCACACUUCCCGGCCUUU
Aedes aegypti
 
dme-miR-311 miR-311 Drosophila melanogaster
UAUUGCACAUUCACCGGCCUGA
Aedes aegypti
 
dme-miR-312 miR-312 Drosophila melanogaster
UAUUGCACUUGAGACGGCCUGA
Aedes aegypti
 
dme-miR-313 miR-313 Drosophila melanogaster
UAUUGCACUUUUCACAGCCCGA
Aedes aegypti
 
dme-miR-314 miR-314 Drosophila melanogaster
UAUUCGAGCCAAUAAGUUCGG
Aedes aegypti
 
aga-miR-315 miR-315 Anopheles gambiae
UUUUGAUUGUUGCUCAGAAAGC
Aedes aegypti
 
dme-miR-316 miR-316 Drosophila melanogaster
UGUCUUUUUCCGCUUACUGGCG
Aedes aegypti
 
aga-miR-317 miR-317 Anopheles gambiae
UGAACACAUCUGGUGGUAUCUCAGU
Aedes aegypti
 
dme-miR-318 miR-318 Drosophila melanogaster
UCACUGGGCUUUGUUUAUCUCA
Aedes aegypti
 
dme-miR-1003 miR-1003 Drosophila melanogaster
UCUCACAUUUACAUAUUCACAG
Aedes aegypti
 
dme-miR-1004 miR-1004 Drosophila melanogaster
UCUCACAUCACUUCCCUCACAG
Aedes aegypti
 
dme-miR-1005 miR-1005 Drosophila melanogaster
UCUGGAAUCUUUAAUUCGCAG
Aedes aegypti
 
dme-miR-1006 miR-1006 Drosophila melanogaster
UAAAUUCGAUUUCUUAUUCAUAG
Aedes aegypti
 
dme-miR-1007 miR-1007 Drosophila melanogaster
UAAGCUCAAUUAACUGUUUGCA
Aedes aegypti
 
dme-miR-1008 miR-1008 Drosophila melanogaster
UCACAGCUUUUUGUGUUUACA
Aedes aegypti
 
dme-miR-1009 miR-1009 Drosophila melanogaster
UCUCAAAAAUUGUUACAUUUCAG
Aedes aegypti
 
dme-miR-1010 miR-1010 Drosophila melanogaster
UUUCACCUAUCGUUCCAUUUGCAG
Aedes aegypti
 
dme-miR-1011 miR-1011 Drosophila melanogaster
UUAUUGGUUCAAAUCGCUCGCAG
Aedes aegypti
 
dme-miR-1012 miR-1012 Drosophila melanogaster
UUAGUCAAAGAUUUUCCCCAUAG
Aedes aegypti
 
dme-miR-1013 miR-1013 Drosophila melanogaster
AUAAAAGUAUGCCGAACUCG
Aedes aegypti
 
dme-miR-1014 miR-1014 Drosophila melanogaster
AAAAUUCAUUUUCAUUUGCAG
Aedes aegypti
 
dme-miR-1015 miR-1015 Drosophila melanogaster
UCCUGGGACAUCUCUCUUGCAG
Aedes aegypti
 
dme-miR-1016 miR-1016 Drosophila melanogaster
UUCACCUCUCUCCAUACUUAG
Aedes aegypti
 
dme-miR-1017 miR-1017 Drosophila melanogaster
GAAAGCUCUACCCAAACUCAUCC
Aedes aegypti
 
aga-bantam bantam Anopheles gambiae
UGAGAUCACUUUGAAAGCUGAUU
Anopheles gambiae
 
aga-let-7 let-7 Anopheles gambiae
UGAGGUAGUUGGUUGUAUAGU
Anopheles gambiae
 
aga-miR-iab-4 miR-iab Anopheles gambiae
ACGUAUACUGAAUGUAUCCUGA
Anopheles gambiae
 
aga-miR-1 miR-1 Anopheles gambiae
UGGAAUGUAAAGAAGUAUGGAG
Anopheles gambiae
 
aga-miR-2 miR-2 Anopheles gambiae
GCUCAUCAAAGCUGGCUGUGAUA
Anopheles gambiae
 
dme-miR-3 miR-3 Drosophila melanogaster
UCACUGGGCAAAGUGUGUCUCA
Anopheles gambiae
 
dme-miR-4 miR-4 Drosophila melanogaster
AUAAAGCUAGACAACCAUUGA
Anopheles gambiae
 
dme-miR-5 miR-5 Drosophila melanogaster
AAAGGAACGAUCGUUGUGAUAUG
Anopheles gambiae
 
dme-miR-6 miR-6 Drosophila melanogaster
UAUCACAGUGGCUGUUCUUUUU
Anopheles gambiae
 
aga-miR-7 miR-7 Anopheles gambiae
UGGAAGACUAGUGAUUUUGUUGU
Anopheles gambiae
 
aga-miR-8 miR-8 Anopheles gambiae
UAAUACUGUCAGGUAAAGAUGUC
Anopheles gambiae
 
aga-miR-9a miR-9 Anopheles gambiae
UCUUUGGUUAUCUAGCUGUAUGA
Anopheles gambiae
aga-miR-9c miR-9 Anopheles gambiae
UCUUUGGUAUUCUAGCUGUAGA
Anopheles gambiae
aga-miR-9b miR-9 Anopheles gambiae
ACUUUGGUGAUUUUAGCUGUAUG
Anopheles gambiae
 
aga-miR-10 miR-10 Anopheles gambiae
ACCCUGUAGAUCCGAAUUUGU
Anopheles gambiae
 
dme-miR-11 miR-11 Drosophila melanogaster
CAUCACAGUCUGAGUUCUUGC
Anopheles gambiae
 
dme-miR-12 miR-12 Drosophila melanogaster
UGAGUAUUACAUCAGGUACUGGU
Anopheles gambiae
 
aga-miR-13b miR-13 Anopheles gambiae
UAUCACAGCCAUUUUGACGAGU
Anopheles gambiae

Page 1 of 88
1 2 3 4 5 6 7 8 9 10 11 .. 88 next >>

spacer
spacer